European Medicines Agency - Human Medicines - Orphan medicinal products - Summaries of opinion on orphan designation

abrir aquí para acceder al documento general y desde allí a las moléculas de interés:
European Medicines Agency - Human Medicines - Orphan medicinal products - Summaries of opinion on orphan designation

CONTENIDOS:
Human medicines - Orphan medicinal products
Summaries of opinion on orphan designation

Note: Draft status is awarded to a title when the document is pending comments from patients' representative organisation

Displayed rows: 619ResetSearch by name Search by orphan condition Positive/Negative Date

( -)-( 2R)-3-(2-hydroxymethylindanyl-4-oxy)-phenyl-4,4,4-trifluorobutane-1-sulfonate moderate and severe closed traumatic brain injury Positive 24/04/2009

1-deoxygalactonojirimycin hydrochloride Fabry disease Positive - Draft 27/01/2009
1-{ 3-[3-(4-chlorophenyl)propoxy] propyl}piperidine, hydrochloride narcolepsy Positive 04/12/2007

( 1R,2S) 6-bromo-alpha-[ 2-(dimethylamino)ethyl]-2-methoxy-alpha-(1-naphthyl)-beta-phenyl-3-quinolineethanol tuberculosis Positive 04/01/2006

( 1R,2R)-octanoic acid[ 2-(2',3'-dihydro-benzo[1,4] dioxin-6'-yl)-2-hydroxy- 1-pyrrolidin-1-ylmethyl-ethyl]-amide-L-tartaric acid salt Gaucher disease Positive 02/07/2008

( 1R,2R,4S)-4-{ (2R)-2[(3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R,27R,34aS)-9,27
dihydroxy-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-1,5,11,28,29-pentaoxo
1,4,5,6,9,10,11,12,13,14,21,22,23,24,25,26,27,28,29,31,32,33,34,34a-tetra-cosahydro-3H-23,27-epoxypyrido[2,1-c][1,4] oxazacyclohentriacontin-3-yl]propyl}-2-methoxy-cyclohexyldimethylphosphinate soft tissue sarcoma Positive 29/11/2005

( 1R,2R,4S)-4-{ (2R)-2-[(3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R,27R,34aS)-9,27 dihydroxy-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-1,5,11,28,29-pentaoxo- 1,4,5,6,9,10,11,12,13,14,21,22,23,24,25,26,27,28,29,31,32,33,34,34a-tetra-cosahydro-3H-23,27-epoxypyrido[2,1-c][1,4]oxazacyclohentriacontin-3-yl]propyl}-2-methoxy-cyclohexyldimethylphosphinate primary malignant bone tumours Positive 04/01/2006

1,2-bis( methylsulphonyl)-1-(2-chloroethyl)-2-[(methylamino)carbonyl]hydrazine acute myeloid leukaemia Positive 09/02/2006

1,3-propanedisulfonic acid, disodium salt systemic secondary amyloidosis Positive - Draft 10/02/2009

1,5-( butylimino)-1,5-dideoxy, D-glucitol Gaucher disease Positive - Draft 10/02/2009

2,2-dimethylbutyric acid, sodium salt beta thalassaemia intermedia and major Positive - Draft 12/03/2009

( 2-aminoethyl) carbamic acid ( 2R,5S,8S,11S,14R,17S,19aS)-11-(4-aminobutyl)-5-benzyl-8-(4-benzyloxy benzyl)-14-(1H-indol-3-ylmethyl)-4,7,10,13,16,19-hexaoxo-17-phenyloctadecahydro-3a,6,9,12,15,18-hexaazacyclopentacyclooctadecen-2-yl ester, di[(S)-2-aminosuccinic acid] salt (pasireotide) functional gastro-entero-pancreatic endocrine tumours Positive 03/09/2006

2-[ [3-({ 4-[(5-{2-[(3-fluorophenyl)amino]-2-oxoethyl} -1H-pyrazol-3-yl)amino]-quinazolin-7-yl}oxy)propyl](ethyl)amino]ethyl dihydrogen phosphate trihydrate acute myeloid leukaemia Positive 24/04/2009

2,2-dimethylbutyric acid, sodium salt sickle cell disease Positive - Draft 08/04/2009

2,3,4,5 tetrahydro-2,8-dimethyl-5-[ 2-(6-methyl-3-pyridinyl)ethyl]-1H-pyrido[4,3-b]indole dihydrochloride Huntington’s disease Positive - Draft 17/02/2009

2-( 4-(diethylamino) phenyl)-6-methyl-2H-benzo[d] [1,2,3] triazol-5-amine Duchenne muscular dystrophy Positive - Draft 27/01/2009

2'-O-methyl-phosphorothioate oligonucleotide Duchenne muscular dystrophy Positive 24/08/2006

2-chloro-9-[ 2-deoxy-2-fluoro-ß-D-arabinofuranosyl]adenine acute lymphoblastic leukaemia Positive - Rev 6 18/08/2008

2-chloro-9-[ 2-deoxy-2-fluoro-ß-D-arabinofuranosyl]adenine acute myeloid leukaemia Positive - Rev 3 18/08/2008

2-Methoxy-5-[ (IZ)-2-(3,4,5-trimethoxyphenyl) ethenyl]-phenol anaplastic thyroid cancer Positive 05/11/2004

2-{ 4-[(5,6-diphenylpyrazin-2-yl)(isopropyl)amino] butoxy}-N-(methylsulfonyl)acetamide pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Positive 04/01/2006

( 2S)-2-[ (4R)-2-oxo-4-propyltetrahydro-1H-pyrrol-1-yl] butanamide progressive myoclonic epilepsies Positive - Rev 1 18/08/2008

3-methoxy-pregnenolone spinal cord injury Positive 02/07/2008

3-( 4'aminoisoindoline-1'-one)-1-piperidine-2,6-dione myelodysplastic syndromes Positive - Rev 2 29/07/2008

3-( 4'aminoisoindoline-1'-one)-1-piperidine-2,6-dione multiple myeloma Positive - Rev 3 29/07/2008

3.4 diaminopyridine phosphate Lambert-Eaton myasthenic syndrome Positive - Rev 2 18/08/2008

3-[ 5-(2-fluoro-phenyl)-[1,2,4] oxadiazole-3-yl]-benzoic acid cystic fibrosis Positive - Rev 3 04/07/2007

3-[ 5-(2-fluoro-phenyl)-[1,2,4] oxadiazole-3-yl]-benzoic acid Duchenne muscular dystrophy Positive - Rev 2 04/07/2007

4-[ 123I] iodo-L-phenylalanine diagnosis of glioma Positive 24/04/2009

4-[ 131I] iodo-L-phenylalanine glioma Positive 24/04/2009

4-imino-1, 3-diazobicyclo-[ 3.1.0]-hexan-2-one pancreatic cancer Positive - Rev 1 29/11/2005

4-Amino-1-[ 5-O-[(2R,4S)-2-oxido-4-(4-pyridinyl)-1,3,2-dioxaphosphorinan-2-yl]-β-D-arabinofuranosyl]-2(1H)-pyrimidinone hepatocellular carcinoma Positive 22/01/2008

4-amino-5-oxo-4 ( pyridinium-1-ylmethyl) proline renal cell carcinoma Positive 24/08/2006

4-amino-( 6R,S)-5,6,7,8-tetrahydro-L-biopterin dihydrochloride moderate and severe traumatic brain injury Positive - Draft 24/02/2009

4-ethoxy-2-( piperazin-1-yl)-7-(pyridin-4-yl)-5H-pyrimido[5,4-b]indol chronic lymphocytic leukaemia Positive 29/07/2008

4-[ 3-(methylsulfonyl)phenyl]-1-propylpiperidine x HC1 Huntington's disease Positive - Rev 1 04/07/2007

4-( 3,5-bis-(hydroxy-phenyl)-1,2,4) triazol-1-yl)-benzoic acid chronic iron overload requiring chelation therapy Positive - Rev 2 28/02/2007

4-[ 3,5-bis(trimethylsilyl)benzamido] benzoic acid hepatocellular carcinoma Positive 29/07/2008

4,5-dihydro-2-( 2,4-dihydroxyphenyl)-4-methylthiazole-4(S)-carboxylic acid chronic iron overload requiring chelation therapy Positive 26/04/2004

4,7,10,13,16,19-docosahexaenoic acid retinitis pigmentosa Positive 02/04/2009

5-( ethylsulfonyl)-2-(naphthalen-2-yl)benzo[d] oxazole Duchenne muscular dystrophy Positive - Draft 12/03/2009

5-aminolevulinic acid hydrochloride intra-operative photodynamic diagnosis of residual glioma Positive - Rev 1 04/12/2007

5'CTG CCA CGT TCT CCT GC-( 2' methoxy)A-(2' methoxy)C-(2'methoxy)C-3' myasthenia gravis Positive 06/09/2005

5-methyl-pyridine-2-sulfonic acid 6-( 2-hydroxyethoxy)-5-(2-methoxyphenoxy)-2- (2-1H-tetrazol-5-yl-pyridin-4-yl)-pyrimidin-4-ylamide sodium salt (1:2) (Clazosentan) aneurysmal subarachnoid haemorrhage Positive - Rev 1 12/12/2005

5'-O-( trans-9"-octadecenoyl)-1-ß-D-arabinofuranosyl cytosine acute myeloid leukaemia Positive - Rev 1 29/07/2008

5( S)-( 2'-hydroxy ethoxy)-20(S)-camptothecin osteosarcoma Positive 29/07/2008

5,6,7,8 tetrahydrobiopterin hyperphenylalaninemia Positive - Rev 1 23/02/2007

5-10-methylene-tetrahydrofolate pancreatic cancer in combination with 5-fluorouracil Positive - Rev 1 12/12/2005

5-10-methylene-tetrahydrofolic acid pancreatic cancer in combination with 5-fluorouracil Positive 28/09/2004

8-cyclopentyl-1,3-dipropylxanthine cystic fibrosis Positive - Draft 10/02/2009

17-allylamino-17-demethoxygeldanamycin chronic myeloid leukemia Positive 01/07/2005

17-allylamino-17-demethoxygeldanamycin multiple myelom Positive 06/01/2006

17-(allylamino)-17-demethoxygeldanamycin hydroquinone hydrochloride malignant gastrointestinal stromal tumours Positive - Rev 1 18/08/2008

( -)-17-(cyclopropylmethyl)-3,14 s-dihydroxy-4,5 ƒ¿-epoxy-6s-[N-methyl-trans-3-(3-furyl) acrylamido] morphinan hydrochloride(intravenous use) uremic pruritus Positive - Rev 3 10/02/2009

26 base single stranded phosphodiester DNA oligonucleotide renal cell carcinoma Positive 24/08/2006

26 base single stranded phosphodiester DNA oligonucleotide pancreatic cancer Positive 24/08/2006

a-1-acid glycoprotein cocaine poisoning Positive 26/04/2004

abetimus sodium lupus nephritis Positive - Draft 03/03/2009

acadesine B-cell chronic lymphocytic leukemia Positive 29/06/2005

acetylcysteine idiopathic pulmonary fibrosis Positive 01/07/2005

acitylsalicylic acid polycythemia vera Positive 06/12/2004

adeno-associated viral vector containing modified U7 snRNA gene Duchenne muscular dystrophy Positive 11/10/2005

adeno-associated viral vector containing the human alpha sarcoglycan gene alpha sarcoglycanopathy Positive 02/04/2009

adeno-associated viral vector containing the human calpain 3 gene calpainopathy Positive - Draft 24/02/2009

adeno-associated viral vector containing the human gamma sarcoglycan gene gamma sarcoglycanopathy Positive 11/10/2005

adeno-associated viral vector expressing lipoprotein lipase lipoprotein lipase deficiency Positive - Rev 1 07/03/2007

adeno-associated viral vector serotype 5 containing the human ABCA4 gene Stargardt’s disease Positive - Draft 20/03/2009

adenoviral vector containing human p53 gene Li-Fraumeni syndrome Positive 02/04/2009

adenovirus associated viral vector serotype 4 containing the human RPE65 gene Leber's congenital amaurosis Positive 22/01/2008

adenovirus associated viral vector serotype 4 containing the human RPE65 gene retinitis pigmentosa Positive 02/07/2008

adenovirus-interferon gamma-coding DNA sequence cutaneous T-cell lymphoma Positive - Rev 2 23/10/2003

adenovirus-mediated herpes simplex virus - thymidine kinase ( HSV-tk) gene high grade glioma with subsequent use of ganciclovir sodium Positive 06/01/2003

aldesleukin (inhalation use) renal cell carcinoma Positive - Rev 1 23/02/2007

alfimeprase acute peripheral arterial occlusion Positive - Rev 2 29/07/2008

allogeneic ex vivo expanded umbilical cord blood cells acute lymphoblastic leukaemia Positive - Draft 20/03/2009

allogeneic ex vivo expanded umbilical cord blood cells acute myeloid leukaemia Positive - Draft 20/03/2009

allogeneic human umbilical cord tissue-derived cells retinitis pigmentosa Positive 10/07/2008

alginate oligosaccharide ( G-block) fragment cystic fibrosis Positive 29/07/2008

alpha-1-acid glycoprotein tricyclic antidepressants poisoning Positive 09/04/2003

alpha-1 antitrypsin ( inhalation use) cystic fibrosis Positive - Rev 1 18/08/2008

alpha-1 antitrypsin ( inhalation use) emphysema secondary to congenital alpha-1 antitrypsin deficiency Positive Rev 1 18/08/2008

alpha-1 proteinase inhibitor emphysema secondary to congenital alpha-1 antitrypsin deficiency Positive 04/12/2007

alpha-1 proteinase inhibitor ( inhalation use) cystic fibrosis Positive 17/01/2008

alpha-1 proteinase inhibitor ( for inhalation use) congenital alpha-1 antitrypsin deficiency Positive 18/08/2008

alvocidib chronic lymphocytic leukaemia Positive 18/08/2008

ambrisentan pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Positive - Rev 2 29/07/2008

amikacin sulfate (liposomal) Pseudomonas aeruginosa lung infection in cystic fibrosis Positive 02/04/2009

amiloride hydrochloride dihydrate cystic fibrosis Positive 07/07/2003

ammonium tetrathiomolybdate Wilson’s disease Positive 10/07/2008

amonafide L-malate acute myeloid leukaemia Positive 10/07/2008

amphotericin B ( for inhalation use) pulmonary fungal infections in patients deemed at risk Positive 02/04/2009

amrubicin hydrochloride small-cell lung cancer Positive - Draft 10/07/2008

anagrelide hydrochloride essential thrombocythaemia Positive - Draft 17/02/2009

anti-CD147 murine monoclonal IgM Note: This product has been withdrawn from the Community Register on request from the sponsor graft-versus-host disease Positive - Rev 1 07/07/2003

a mixture of anti-CD3 mAb ( SPV-T3a)-ricin A chain fusion protein and anti-CD7 mAb (WT1)-ricin A chain fusion protein graft-versus-host disease Positive 27/10/2005

anti epidermal growth factor receptor antibody h-R3 glioma Positive 01/10/2004

anti-epithelial cell adhesion molecule / anti-CD3 monoclonal antibody ovarian cancer Positive - Rev 1 27/10/2005

antisense NF-KBp65 oligonucleotide active ulcerative colitis Positive - Rev 1 23/01/2003

antisense oligonucleotide ( TATCCGGAGGGCTCGCCATGCTGCT) neovascular glaucoma Positive 26/04/2004

antisense oligonucleotide ( TATCCGGAGGGCTCGCCATGCTGCT) corneal graft rejection Positive 04/12/2007

antisense oligonucleotide ( TATCCGGAGGGCTCGCCATGCTGCT) retinopathy of prematurity Positive 26/04/2004

antisense oligonucleotide 5'-d[ P-Thio] (CCCTG CTCCC CCCTG GCTCC)-3' acute myeloid leukaemia Positive 02/04/2009

anti-von Willebrand aptamer thrombotic thrombocytopenic purpura Positive 29/07/2008

aplidine acute lymphoblastic leukaemia Positive 12/12/2005

aplidine multiple myeloma Positive 11/10/2005

apomorphine (oromucosal use) off-periods in Parkinson’s disease not responding adequately to other existing therapies Positive - Draft 03/03/2009

apomorphine hydrochloride ( inhalation use) off-periods in Parkinson’s disease not responding to oral treatment Positive 24/08/2006

arimoclomol amyotrophic lateral sclerosis Positive 02/04/2009

arsenic trioxide acute myeloid leukaemia Positive 10/07/2008

arsenic trioxide acute promyelocytic leukaemia Positive - Rev 2 04/07/2007

arsenic trioxide acute promyelocytic leukaemia Positive - Draft 10/02/2009

arsenic trioxide multiple myeloma Positive - Rev 2 04/07/2007

arsenic trioxide myelodysplastic syndromes Positive - Rev 2 04/07/2007

artesunate malaria Positive - Rev 1 02/07/2008

artesunate malaria Positive 10/07/2008

ascorbic acid Charcot-Marie-Tooth disease type 1A Positive 10/07/2008

autologous CD34+ cells transfected with lentiviral vector containing the human arylsulfatase A cDNA metachromatic leukodystrophy Positive 29/07/2008

autologous CD34+ cells transfected with retroviral vector containing adenosine deaminase gene severe combined immunodeficiency (SCID) due to adenosine deaminase (ADA) deficiency Positive 04/01/2006

autologous CD34+ cells transfected with retroviral vector containing the human gp91 ( phox) gene chronic granulomatous disease Positive 24/04/2009

autologous dendritic cells pulsed with autologous tumour cell lysate glioma Positive
10/07/2008

autologous renal tumour vaccine renal cell carcinoma Positive - Rev 1 08/01/2003

autologous tumor-derived gp96 heat shock protein-peptide complex renal cell carcinoma Positive 04/01/2006

autologous tumor-derived immunoglobulin idiotype coupled to keyhole limpet haemocyanin follicular lymphoma Positive 02/04/2009

autologous urothelial and smooth muscle cells spina bifida Positive 10/07/2008

autologous urothelial and smooth muscle cells spinal cord injury Positive 24/04/2009
avian polyclonal IgY antibody against Pseudomonas aeruginosa cystic fibrosis Positive 24/04/2009

aviptadil acute lung injury Positive 02/04/2009

aviptadil sarcoidosis Positive 22/01/2008

azacitidine acute myeloid leukaemia Positive 02/07/2008

azacitidine myelodysplastic syndromes Positive - Rev 1 14/01/2003

aztreonam lysinate ( inhalation use) gram negative bacterial lung infection in cystic fibrosis Positive - Rev 2 30/05/2007

bacterial lipase malabsorption due to exocrine pancreatic enzyme insufficiency Positive 09/02/2006

becatecarin cancers of the biliary tree Positive 24/04/2009

beclomethasone 17,21-dipropionate ( oral use) intestinal graft-versus-host disease Positive - Rev 2 18/08/2008

benzoic acid, sodium salt non-ketotic hyperglycinaemia Positive - Rev 1 08/01/2003

beraprost sodium pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Positive 04/01/2006

beraprost sodium ( modified release tablet) pulmonary arterial hypertension Positive 24/04/2009

betaine anhydrous homocystinuria Positive - Draft 10/02/2009

bilayer engineered skin composed of keratinocytes from the patient ( autologous) and fibroblasts from a donor (allogeneic) embedded in a plasma matrix epidermolysis bullosa Positive - Draft 27/01/2009

bimosiamose disodium acute lung injury Positive 29/06/2005

biotinylated anti-tenascin monoclonal antibody for use with 90-Yttriumbiotinylated anti-tenascin monoclonal antibody for use with 90-Yttrium glioma Positive 04/01/2006

bosentan pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Positive - Rev 2 28/02/2007

bosentan systemic sclerosis Positive - Rev 1 30/05/2007

bosentan idiopathic pulmonary fibrosis Positive 02/04/2009

boswellia serrata resin extract peritumoral oedema derived from brain tumours Positive - Rev 2 23/02/2007

bovine bile extract pancreatic cancer Positive - Rev 1 07/03/2007

brostallicin soft tissue sarcoma Positive 08/08/2006

bryostatin-1 oesophageal cancer Positive - Rev 2 23/02/2007

budesonide (oral use) Graft-versus-Host disease Positive - Draft 20/02/2009

busulfan (intravenous use) haematopoietic progenitor cell transplantation Positive - Draft 10/02/2009

caffeine citrate primary apnoea of premature newborns Positive - Rev 1 07/03/2007

capsaicin painful HIV-associated neuropathy Negative 19/07/2007

carboxypeptidase G2 adjunctive treatment in patients at risk of methotrexate toxicity Positive 12/12/2005

carbamic acid, [ [4-[[3-[[4-[1-(4-hydroxyphenyl)-1-methylethyl] phenoxy]methyl]phenyl]methoxy]-phenyl]iminomethyl]-,ethyl ester (amelubant) cystic fibrosis Positive - Rev 2 29/11/2005

cardiotrophin-1 prevention of the ischemia/reperfusion injury associated with solid organ transplantation Positive 24/04/2009

carfilzomib multiple myeloma Positive 29/07/2008

carglumic acid isovaleric acidaemia Positive 02/04/2009

carglumic acid methylmalonic acidaemia Positive 02/04/2009

carglumic acid propionic acidaemia Positive 02/04/2009

carmustine ( solution for intratumoural injection) glioma Positive - Rev 1 23/01/2003

catumaxomab gastric cancer Positive - Draft 24/02/2009

celecoxib Familial Adenomatous Polyposis (FAP) Positive - Draft 17/02/2009

cenersen chronic lymphocytic leukaemia Positive - Draft 24/02/2009

chelidonii radix special liquid extract pancreatic cancer Negative 29/07/2008

chimeric-anti-interleukin-6 monoclonal antibody renal cell carcinoma Positive 08/07/2003

chimeric-anti-interleukin 6 monoclonal antibody Castleman’s disease Positive 29/07/2008

chimeric antibody to mesothelin pancreatic cancer Positive 10/07/2008

chimeric IgG monoclonal antibody cG250 renal cell carcinoma Positive - Rev 1 08/01/2003

chimeric monoclonal antibody to shiga-toxin 1 and 2 shiga-toxin producing bacterial
infection Positive 09/02/2006

chlorproguanil hydrochloride and dapsone acute uncomplicated Plasmodium falciparum malaria Negative - Rev 1 08/01/2003

cholest-4-en-3-one, oxime 5q spinal muscular atrophy Positive 11/10/2005

cholest-4-en-3-one, oxime amyotrophic lateral sclerosis Positive 24/04/2009

cholic acid inborn errors in primary bile acid synthesis Positive - Rev 1 18/08/2008

ciclosporin atopic keratoconjunctivitis Positive 22/01/2008

ciclosporin corneal graft rejection Positive 02/07/2008

ciclosporin vernal keratoconjunctivitis Positive - Draft 24/02/2009

ciclosporin Herpes simplex virus stromal keratitis Positive 02/07/2008

ciclosporin (implant) prevention of rejection of corneal transplant Positive 02/04/2009

ciclosporin (inhalation use) graft rejection after lung transplantation Positive - Rev 1 13/12/2007

ciclosporin (inhalation use) graft rejection after lung transplantation Positive - Rev 1
13/12/2007

ciclosporin (inhalation use) graft rejection after lung transplantation Positive - Rev 1 04/12/2007

ciclosporin (inhalation use) graft rejection after lung transplantation Positive - Rev 1 04/12/2007

cilengitide glioma Positive 08/07/2004

ciprofloxacin (inhalation use) cystic fibrosis Positive 17/01/2008

cisplatin (liposomal) pancreatic cancer Positive 04/12/2007

cladribine (subcutaneous use) indolent non-Hodgkin's lymphoma Positive 29/11/2005

colistimethate sodium Pseudonomas aeruginosa lung infection (including colonisation) in cystic fibrosis Positive - Rev 1 08/01/2003

complement factor H atypical Haemolytic Uraemic Syndrome (aHUS) associated with an inherited abnormality of the complement system Positive - Rev 1 29/07/2008

cyclo { {(E,Z)-(2S,3R,4R)-3-hydroxy-4-methyl-2-(methylamino)nona-6,8-dienoyl}-L-2-aminobutyryl-N-methyl-glycyl-N-methyl-L-leucyl-L-valyl-N-methyl-L-leucyl-L-alanyl-D-alanyl-N-methyl-L-leucyl-N-methyl-L-leucyl-N-methyl-L-valyl} chronic non-infectious uveitis Positive 29/07/2008

cyclopropane-1,1-dicarboxylic acid [ 4-(6,7-dimethoxy-quinolin-4-yloxy)-phenyl]-amide (4-fluoro-phenyl)-amide, (L)-malate salt medullary thyroid carcinoma Positive - Draft 20/02/2009

cysteamine hydrochloride cystinosis Positive - Draft 20/02/2009

cytochrome P450 isoform 2B1 gene transfected human embryonic kidney 293 cells encapsulated in polymeric cellulose sulphate pancreatic cancer in combination with ifosfamide Positive - Rev 1 12/12/2005

dasatinib acute lymphoblastic leukaemia Positive - Rev 1 28/02/2007

dasatinib chronic myeloid leukaemia Positive - Rev 1 28/02/2007

decitabine acute myeloid leukaemia Positive 19/07/2007

decitabine myelodysplastic syndromes Positive - Rev 1 30/05/2007

deferoxamine mesilate traumatic spinal cord injury Positive 17/01/2008

defibrotide hepatic veno-occlusive disease (VOD) Positive 12/12/2005

defibrotide hepatic veno-occlusive disease (VOD) Positive 12/12/2005

denileukin diftitox cutaneous T-cell lymphoma Positive - Rev 1 30/05/2007

denufosol tetrasodium cystic fibrosis Positive - Rev 1 04/07/2007

deoxyribose phosphorothioate ( 5’-tct-ccc-agc-gtg-cgc-cat-3’) chronic lymphocytic leukemia Positive - Rev 2 06/01/2005

deoxyribose phosphorothioate ( 5’-tct-ccc-agc-gtg-cgc-cat-3’) multiple myeloma Positive - Rev 2 12/12/2005

deuterium oxide pancreatic cancer Positive - Rev 1 29/11/2005

dexamethasone sodium phosphate encapsulated in human erythrocytes cystic fibrosis Positive 04/01/2006

dexrazoxane anthracycline extravasation Positive - Draft 17/02/2009

dihydroartemisin, piperaquine malaria Positive 29/07/2008

dimethyl sulfoxide severe closed traumatic brain injury Positive 01/07/2005

diphenylcyclopropenone alopecia totalis Positive 24/04/2009

diphenylcyclopropenone alopecia universalis Positive 24/04/2009

donor lymphocyte preparation depleted of functional alloreactive T-cells Graft-versus-Host disease Positive 24/04/2009

doxorubicin carbon/iron magnetically targeted microparticles hepatocellular carcinoma Positive - Rev 1 23/01/2003

doxorubicin hydrochloride ( drug eluting beads) glioma Positive 02/07/2008

doxorubicin hydrochloride (liposomal) soft tissue sarcoma Positive 02/04/2009

doxorubicin polyisohexylcyanoacrylate nanoparticles hepatocellular carcinoma Positive 01/07/2005

drotrecogin alfa (activated) acute respiratory distress syndrome Positive - Draft 24/02/2009

duramycin cystic fibrosis Positive - Rev 1 12/12/2005

( E)-( 1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23-tetraazabicyclo[8. 7.6]tricos-16-ene-3,6,9,19,22-pentone cutaneous T-cell lymphoma Positive - Rev 1 13/10/2005

( E)-( 1S,4S,10S,21R)-7-[(Z)-ethylidene]-4,21-diisopropyl-2-oxa-12,13-dithia-5,8,20,23-tetraazabicyclo[8. 7.6]tricos-16-ene-3,6,9,19,22-pentone peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Positive 04/01/2006

E. Coli heat-shock protein 70 with bovine retinal S-antigen autoimmune uveitisa Positive 08/08/2006

ecteinascidin 743 soft tissue sarcoma Positive - Rev 1 04/12/2007

eculizumab paroxysmal nocturnal haemoglobinuria Positive - Rev 3 04/07/2007

eflornithine hydrochloride Familial Adenomatous Polyposis (FAP) Positive - Rev 2 29/11/2005

elafin pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Positive 02/07/2008

eltrombopag olamine idiopathic thrombocytopenic purpura Positive - Rev 1 02/07/2008

engineered protein inhibitor of human neutrophil elastase cystic fibrosis Positive 26/04/2004

enzastraurin hydrochloride diffuse large B cell lymphoma Positive 10/07/2008

enzastaurin hydrochloride glioma Positive 08/08/2006

epothilone B ovarian cancer Positive - Rev 2 11/06/2003

eptacog alpha (activated) diffuse alveolar haemorrhage Positive - Rev 2 29/07/2008

eptacog alfa (activated) post-neonatal intracerebral haemorrhage Positive 04/12/2007

estradiol hemihydrate and progesterone bronchopulmonary dysplasia in premature neonates of less than 30 weeks of gestational age Positive 04/01/2006

ethanol ( 96 per cent) (gel for injection) congenital lymphatic malformations Positive 28/04/2005

ethanol ( 96 per cent) (gel for injection) congenital venous malformations Positive 28/04/2005
etilefrine low flow priapism Positive - Rev 1 13/12/2002

ethyl eicosopentaenoate Huntington's disease Positive 04/01/2006

everolimus gastro-entero-pancreatic neuroendocrine tumours Positive 02/07/2008

everolimus renal cell carcinoma Positive 19/07/2007

ex-vivo cultured adult human mesenchymal stem cells graft-versus-host-disease Positive 19/07/2007

ex vivo expanded autologous human corneal epithelium containing stem cells corneal lesions, with associated corneal (limbal) stem cell deficiency, due to ocular burns Positive 24/04/2009

exon 44 specific phosphorothioate oligonucleotide Duchenne muscular dystrophy Positive - Draft 12/03/2009

exon 51 specific phosphorothioate oligonucleotide Duchenne muscular dystrophy Positive - Draft 12/03/2009

fampridine Guillain-Barré syndrome Positive 17/01/2008

fenretinide soft tissue sarcoma Positive 29/07/2008

fenretinide primary malignant bone tumours Positive 29/07/2008

filgrastim amyotrophic lateral sclerosis Positive 10/07/2008

filgrastim spinal cord injury Positive 24/04/2009

fluocinolone acetonide ( prolonged-release intrravitreal implant) non-infectious uveitis affecting the posterior segment of the eye Positive - Rev 1 30/05/2007

fluorouracil glioblastoma Positive - Draft 10/02/2009

fomepizole methanol poisoning Positive - Draft 24/02/2009

forodesine hydrochloride acute lymphoblastic leukaemia Positive 13/12/2007

forodesine hydrochloride cutaneous T-cell lymphoma Positive 13/12/2007

fumagillin diarrhoea associated with intestinal microsporidial infection Positive - Rev 2 30/05/2007

G17( 9) gastrin-diphtheria toxoid conjugate gastric cancer Positive - Rev 1 12/12/2005

G17( 9) gastrin-diphtheria toxoid conjugate pancreatic cancer Positive - Rev 1 12/12/2005

gadodiamide (liposomal) adjunctive treatment of glioma Positive - Draft 12/03/2009

gemtuzumab ozogamicin acute myeloid leukaemia Positive 08/11/2004

genetically modified allogenic ( human) tumour cells for the expression of IL-7, GM-CSF, CD80 and CD154, in fixed combination with a DNA-based double stem loop immunomodulator (dSLIM) renal cell carcinoma Positive 24/04/2009

gimatecan glioma Positive - Rev 1 23/02/2007

glutathione cystic fibrosis Positive - Draft 27/01/2009

[ gly2] -recombinant human glucagon-like peptide short bowel syndrome Positive - Draft 10/02/2009

granulocyte macrophage colony stimulating factor receptor antagonist juvenile myelomonocytic leukaemia Positive - Rev 2 29/11/2005

gusperimus trihydrochloride Wegener’s granulomatosis Positive - Draft 03/03/2009

H-Arg-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt & H-Tyr-Leu-Phe-Phe-Tyr-Arg-Lys-Ser-Val-OH, acetate salt TERT positive non-small cell lung cancer in HLA-A2 positive patients Positive - Rev 1 21/10/2008

halofuginone hydrobromide systemic sclerosis Positive - Draft 17/02/2009

H-D-Asp-D-Gln-D-Ser-D-Arg-D-Pro-D-Val-D-Gln-D-Pro-D-Phe-D-Leu-D-Asn-D-Leu-D-Thr-DThr- D-Pro-D-Arg-D-Lys-D-Pro-D-Arg-D-Pro-D-Pro-D-Arg-D-Arg-D-Arg-D-Gln-D-Arg-D-Arg- D-Lys-D-Lys-D-Arg-D-Gly-NH2 acute sensorineural hearing loss (acute acoustic trauma, sudden deafness and surgery induced acoustic trauma) Positive 11/10/2005

H-Val-Ile-Val-Lys-Leu-Ile-Pro-Ser-Thr-Ser-Ser-Ala-Val-Asp-Thr-Pro- Tyr-Leu-Asp-Ile-Thr-Tyr-His-Phe-Val-Ala-Gln-Arg-Leu-Pro-Leu-OH myasthenia gravis Positive - Draft 27/01/2009

heparin-binding epidermal growth factor-like growth factor ( HB-EGF), amino acids 74-148 necrotizing enterocolitis Positive 02/04/2009

heparin sodium cystic fibrosis Positive - Draft 27/01/2009

heparin sodium idiopathic pulmonary fibrosis Positive 01/07/2005

heparin sodium ( inhalation use) cystic fibrosis Positive - Draft 08/08/2006

hepatitis C immunoglobulin recurrent hepatitis C virus induced liver disease in liver transplant recipients Positive - Rev 1 18/08/2008

herpes simplex virus lacking infected cell protein 34. 5 glioma Positive 23/10/2003

herpes simplex 1 virus-thymidine kinase and truncated low affinity nerve growth factor receptor transfected donor lymphocytes adjunctive treatment of haematopoietic cell transplantation Positive 04/01/2006

heterologous human adult liver derived stem cells Crigler-Najjar syndrome Positive 02/07/2008

heterologous human adult liver derived stem cells ornithine-transcarbamylase deficiency Positive 10/07/2008

histamine dihydrochloride acute myeloid leukemia Positive - Rev 1 07/03/2007

histamine dihydrochloride malignant melanoma Negative 16/03/2005

HLA-A2 restricted CD8 T-cell line expressing MART-1 T-cell receptor MART-1 positive malignant melanoma in HLA-A2 positive patients Positive - Draft 17/02/2009

HLA-B27-derived peptide ( amino acid 125-138) autoimmune uveitis Positive 09/06/2006

HLA class I/II binding tumour associated peptides ( ADF-APO-CCN-GUC-K67-MET-MMP-MUC-RGS) renal cell carcinoma Positive 10/07/2008

homoharringtonine acute myeloid leukemia Positive 06/01/2006

homoharringtonine chronic myeloid leukaemia Positive 28/09/2004

H-Tyrosine-Glycine-Phenylalanine-Glycine-Glycine-O chronic idiopathic myelofibrosis Positive 04/01/2006

human alpha1-proteinase inhibitor ( respiratory use) emphysema secondary to congenital alpha-1-antitrypsin deficiency Positive - Draft 24/02/2009

human anti-intercellular adhesion molecule-1 monoclonal antibody multiple myeloma Positive - Draft 17/02/2009

human autologous bone-forming cells derived from bone marrow stem cells non-traumatic osteonecrosis Positive 17/01/2008

human autologous mesenchymal adult stem cells extracted from adipose tissue anal fistula Positive 11/10/2005

human coagulation factor X hereditary factor X deficiency Positive 29/07/2008

human cytomegalovirus immunoglobulin congenital cytomegalovirus infection following primary
cytomegalovirus infection Positive - Draft 27/01/2009

human engineered monoclonal antibody specific for transforming growth factor ß1 ( TGF-ß1) systemic sclerosis Positive - Rev 1 23/02/2007

human engineered monoclonal antibody specific for transforming growth factor β2 ( CAT-152) prevention of scarring in glaucoma filtration surgical procedure Positive - Draft 24/02/2009

human heterologous liver cells ( for infusion) acute liver failure Positive 24/04/2009

human heterologous liver cells ( for infusion) ornithine-transcarbamylase deficiency Positive - Draft 22/01/2008

human immunoglobulin polymyositis Positive 26/04/2004

human immunoglobulin G1 constant region - human ectodysplasin-A1 receptor-binding domain fusion protein X-linked hypohidrotic ectodermal dysplasia (Christ-Siemens-Touraine Syndrome)s Positive - Rev 2 04/12/2007

human interleukin-2 ( glycosylated tetrasaccharide, glycosylated trisaccharide and non-glycosylated) (inhalation use) renal cell carcinoma Positive 29/07/2008

human milk fat globule 1 / Yttrium (90Y) human milk fat globule 1 - S-p-isothiocyanatobenzyl-diethylenetriaminepentaacetic acid ovarian cancer Positive 02/06/2004

human monoclonal antibody against CD4 cutaneous T-cell lymphoma Positive - Rev 2 18/08/2008

human monoclonal antibody against HLA-DR chronic lymphocytic leukaemia Positive- Rev 1 29/07/2008

human monoclonal antibody against HLA-DR Hodgkin’s lymphoma Positive - Rev 1 29/07/2008

human monoclonal antibody against HLA-DR multiple myeloma Positive - Rev 1 29/07/2008

human monoclonal antibody against inhibitory killer cell lg-like receptors ( 1-7 F9) acute myeloid leukaemia Positive - Rev 1 24/04/2009

human monoclonal antibody against Pseudomonas aeruginosa serotype O11 pneumonia caused by serotype O11 Pseudomonas aeruginosa Positive - Draft 13/01/2009

human monoclonal hepatitis B immunoglobulins hepatitis B re-infection following liver transplantation Positive 10/07/2004

human papilloma virus type 16 E6/E7 synthetic long peptides epithelial neoplasia of the vulva positive for human papilloma virus Positive 29/07/2008

human plasminogen ligneous conjunctivitis Positive 17/01/2008

human Staphylococcus aureus immunoglobulin Staphylococcus aureus bacteraemia Positive - Rev 1 18/08/2008

human Staphylococcus aureus polyclonal immunoglobulin and human Staphylococcus epidermidis polyclonal immunoglobulin late onset sepsis in premature infants of less than or equal to 32 weeks gestational age Positive - Rev 1 29/07/2008

human telomerase reverse transcriptase peptide ( 611-626) pancreatic cancer Positive 02/04/2009

human transferrin conjugated to mutant diphtheria toxin glioma Positive - Rev 2 04/12/2007

humanised agonistic anti-CD28 monoclonal antibody B-cell chronic lymphocytic leukemia Positive 01/07/2005

humanised antibody fragment ( Ep-CAM)-truncated Pseudomonas exotoxin A fusion protein Ep-CAM-positive squamous cell carcinoma of the head and neck Positive - Rev 1 12/12/2005

humanized anti-KSA monoclonal antibody-human interleukin-2 fusion protein renal cell carcinoma Positive - Rev 2 23/05/2003

humanised anti-HM1. 24 monoclonal antibody multiple myeloma Positive 28/04/2005

humanised monoclonal antibody to the folate receptor alpha ovarian cancer Positive 10/07/2008

hydrocortisone ( modified release tablet) adrenal insufficiency Positive 04/12/2007
hydrocortisone ( modified release tablet) congenital adrenal hyperplasia Positive 19/07/2007

hydroxyurea sickle cell syndrome Positive - Rev 2 29/07/2008

ibritomomab tiuxetan for use with 90Yttrium B-cell non-Hodgkin´s lymphoma Negative - Rev 1 08/01/2003

ibuprofen for the prevention of patent ductus arteriosus in premature neonates
of less than 34 weeks of gestational age Positive - Draft 10/02/2009

ibuprofen patent ductus arteriosus Positive - Draft 10/02/2009

ibuprofen L-lysinate patent ductus arteriosus in premature neonates of less than 34 weeks of gestational age Negative 11/10/2005

ibuprofen L-lysinate patent ductus arteriosus in premature neonatesof less than 34 weeks of gestational age Negative 11/10/2005

icatibant acetate angioedema Positive 09/04/2003

idebenone Leber's hereditary optic neuropathy Positive 10/07/2008

idebenone Duchenne muscular dystrophy Positive 19/07/2007

idebenone Friedreich’s ataxia Positive 10/02/2009

idebenone Friedreich’s ataxia Positive 11/10/2005

iloprost primary and of the following forms of secondary pulmonary hypertension: connective tissue disease pulmonary hypertension, drug-induced pulmonary hypertension, portopulmonary hypertension, pulmonary hypertension associated with congenital heart disease and chronic thromboembolic pulmonary hypertension Positive - Draft 12/03/2009

imatinib mesilate acute lymphoblastic leukaemia Positive - Rev 1 28/02/2007

imatinib mesilate chronic eosinophilic leukaemia and the hypereosinophilic syndrome Positive - Rev 1 28/02/2007

imatinib mesilate dermatofibrosarcoma protuberans Positive - Rev 1 28/02/2007

imatinib mesilate malignant gastrointestinal stromal tumours Positive - Rev 1 29/11/2005

imatinib mesilate mastocytosis Positive - Rev 1 04/12/2007

imatinib mesilate chronic myeloid leukemia Positive - Rev 2 28/02/2007

imatinib mesilate myelodysplastic / myeloproliferative diseases Positive - Rev 1 28/02/2007

imexon ovarian cancer Positive - Draft 08/08/2006

inolimomab graft-versus-host disease Positive - Rev 1 18/08/2008

interferon beta acute lung injury Positive 02/07/2008

interferon gamma idiopathic pulmonary fibrosis Positive - Rev 2 30/05/2007

interferon gamma idiopathic pulmonary fibrosis Positive 02/07/2008

iodine ( 131I) anti-CEA sheep-human chimeric monoclonal antibody pancreatic cancer Positive 21/05/2003

iodine ( 131I) chimeric IgG monoclonal antibody cG250 renal cell carcinoma Positive - Rev 2 11/10/2005

iodine ( 131I) chlorotoxin glioma Positive 02/07/2008

iodine ( 131I) iobenguane neuroblastoma Positive 10/07/2008

iodine (131I) radiolabeled anti-nucleohistone H1 chimeric biotinylated monoclonal antibody glioma Positive - Rev 1 26/05/2003

iodine ( 123I) serum amyloid P extent of histologically proven amyloidodis Positive - Rev 1 29/07/2008

iodine ( 131I) tositumomab follicular lymphoma Positive - Rev 2 12/12/2005

irinotecan hydrochloride ( drug eluting beads) glioma Positive 02/07/2008

isofagomine tartrate Gaucher disease Positive 17/01/2008

l, 1'-[ 1,4-phenylenebis (methylene)]-bis-1,4,8,11- tetraazacyclotetradecane mobilize progenitor cells prior to stem cell transplantation Positive - Rev 1 18/08/2008

laronidase mucopolysaccharidosis, type I Positive - Draft 17/02/2009

L-asparaginase acute lymphoblastic leukemia Positive 26/07/2005

L-asparaginase encapsulated in erythrocytes acute lymphoblastic leukaemia Positive 29/07/2008

L-lysine-N-acetyl-L-cysteinate cystic fibrosis Positive - Draft 10/02/2009

L-threo-3,4-dihydroxyphenylserine orthostatic hypotension in patients with multiple system atrophy Positive 02/07/2008

L-threo-3,4-dihydroxyphenylserine orthostatic hypotension in patients with pure autonomic failure Positive 02/07/2008

lenalidomide chronic lymphocytic leukaemia Positive 17/01/2008

lentiviral vector containing the human Wiskott Aldrich syndrome protein gene Wiskott Aldrich syndrome Positive - Draft 13/01/2009

lestaurtinib acute myeloid leukaemia Positive - Draft 24/02/2009

levamisol hydrochloride nephrotic syndrome Positive - Draft 08/08/2006

levodopa/carbidopa ( gastroenteral use) advanced idiopathic Parkinson’s disease with severe motor fluctuations and not responding to oral treatment Positive Draft 03/03/2009

levofloxacin hemihydrate cystic fibrosis Positive - Draft 06/01/2009

liarozole congenital ichthyoses Positive 26/09/2003

lumiliximab chronic lymphocytic leukaemia Positive 10/07/2008

lusupultide aspiration pneumonitis requiring intubation and mechanical ventilation Positive - Rev 1 18/08/2008

lusupultide acute respiratory distress syndrome Positive - Draft 10/02/2009

lutetium ( 177Lu)-N-[(4,7,10-Tricarboxymethyl-1,4,7,10-tetraazacyclododec-1-yl)acetyl]-D-phenylalanyl-L-cysteinyl-L-tyrosyl-D-tryptophanyl-L-lysyl-L-threoninyl-L-cysteinyl-L-threonine-cyclic(2-7) disulfide gastro-entero-pancreatic neuroendocrine tumours Positive 10/07/2008

( manganese, dichloro [ (4aR, 13aR, 17aR, 21aR)-1, 2, 3, 4, 4a, 5, 6, 12, 13, 13a, 14, 15, 16, 17, 17a, 18, 19, 20, 21, 21a-eicosahydro-11, 7-nitrilo-7H-dibenzo[ b,h] [1,4,7,10] tetraazacycloheptadecine-κN5, κN13, κN18, κN21, κN22]-) for the prevention of oral mucositis in head and neck cancer patients undergoing radiation therapy Positive 10/07/2008

mannitolum cystic fibrosis Positive - Rev 2 29/07/2008

maribavir for the prevention of cytomegalovirus (CMV) disease in patients with impaired cell mediated immunity deemed at risk Positive- Rev 1 29/07/2008

mecasermin primary growth hormone insensitivity syndrome Positive - Rev 2 04/07/2007
mecasermin primary insulin-like growth factor-1 deficiency due to molecular or genetic defects Positive - Draft 13/01/2009

mecasermin rinfabate prevention of retinopathy of prematurity in neonates of less than 32 weeks of gestational age Positive - Draft 13/01/2009

mecasermin rinfabate primary insulin-like growth factor-1 deficiency due to molecular or genetic defects Positive - Draft 13/01/2009

melatonin non-24-hour sleep-wake disorders in blind people with no light perception Positive 27/10/2005

mepolizumab hypereosinophilic syndrome Positive 06/01/2006

mercaptopurine acute lymphoblastic leukaemia Positive 02/07/2008

mecasermin rinfabate patients with growth hormone (GH) gene deletion who have developed neutralizing antibodies to GH Positive 02/04/2009

metastable technetium 99 [ 99mTc] demogastrin 2 diagnosis of medullary thyroid carcinoma Positive - Draft 13/01/2009

methotrexate acute lymphoblastic leukaemia Positive 02/07/2008

methoxsalen Graft-versus-Host disease Positive - Draft 13/01/2009

methyl 4, 6-diamino-2-[ 1-(2-fluorobenzyl)-1H-pyrazolo [3, 4-b]pyridine-3-yl]-5-pyrimidinyl(methyl)carbamate pulmonary arterial hypertension including chronic thromboembolic pulmonary hypertension Positive 10/07/2008

midazolam hydrochloride ( for oromucosal use) seizures which continue for at least five minutes Negative 12/12/2005

midostaurin acute myeloid leukemia Positive 11/10/2005

mifepristone Cushing's syndrome secondary to ectopic ACTH secretion Positive 11/10/2005

mifepristone endogenous hypercortisolism (Cushing’s syndrome) Positive - Draft 12/03/2009

miglustat Niemann-Pick disease, type C Positive 24/08/2006

milatuzumab multiple myeloma Positive - Draft 20/02/2009

milatuzumab chronic lymphocytic leukaemia Positive - Draft 20/02/2009

miltefosine Acanthamoeba keratitis Positive - Rev 1 18/08/2008

miltefosine cutaneous T-cell lymphoma Positive - Draft 06/01/2009

miltefosine visceral leishmaniasis Positive - Rev 3 11/06/2003

mitotane adrenal cortical carcinoma Positive - Rev 3 29/11/2005

mitotane adrenal cortical carcinoma Positive - Rev 3 29/11/2005

monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E anaplastic large cell lymphoma Positive - Draft 27/01/2009

monoclonal antibody against human CD30 covalently linked to the cytotoxin monomethylauristatin E Hodgkin lymphoma Positive - Draft 27/01/2009

monoclonal antibody to human interleukin-6 post-transplant lymphoproliferative disorders Positive - Rev 2 18/08/2008

muramyl tripeptide phosphatidyl ethanolamine osteosarcoma Positive 12/11/2004

murine anti-idiotypic antibody against OC125 antibody against CA125 antigen ovarian cancer Positive - Rev 2 04/01/2006

murine anti-CD22 antibody variable region fused to truncated Pseudomonas exotoxin 38 hairy cell leukaemia Positive - Draft 13/01/2009

mycobacterial cell wall complex superficial bladder cancer Negative 14/01/2003

myristoylated-peptidyl-recombinant human CD59 paroxysmal nocturnal haemoglobinuria Positive - Rev 2 04/07/2007

myristoylated-peptidyl-recombinant SCR1-3 of human complement receptor type I post transplantation graft dysfunction Positive - Rev 2 04/07/2007

N2'-Deacetyl-N2'-[ 4-methyl-4-(oxobuthyldithio)-1-oxopentyl]-maytansine-chimerized anti-CD138 IgG4 monoclonal antibody multiple myeloma Positive - Draft 12/03/2009

N-( 2-amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide Hodgkin's lymphoma Positive 17/01/2008

N- ( 2-amino-phenyl)-4-[(4-pyridin-3-yl-pyrimidin-2-ylamino)-methyl] benzamide acute myeloid leukaemia Positive 10/07/2008

N-( 2,4-Di-tert-butyl-5-hydroxyphenyl)-1,4-dihydro-4-oxoquinoline-3-carboxamide cystic fibrosis Positive 02/04/2009

N-3[ [4(aminoiminomethyl)benzoyl] amino]propyl]-1-[[2,4-dichloro-3-[[2,4-dimethyl-8-quinolinyl)oxy]methyl] phenyl]sulphonyl]-(2S)-2-pyrrolidinecarboxamide, di(methanesulfonate) (anatibant) moderate and severe traumatic brain injury Positive - Rev 2 23/02/2007

N-[ 4-( 3-amino-1H-indazol-4 yl)phenyl]-N’-(2-fluoro-5-methylphenyl) urea hepatocellular carcinoma Positive 02/07/2008

N-(5-tert-butylisoxazol-3-yl)-N'-{4-[7-(2-(morpholin-4-yl)ethoxy) imidazo[2,1-b][1,3]benzothiazol-2-yl]phenyl}urea di-hydrochloride salt acute myeloid leukaemia Positive - Draft 08/04/2009

N'-( 5-chloro-2-hydroxy-3-methylbenzylidene)-2,4-dihydroxybenzhydrazi partial deep dermal and full thickness burn wounds Positive - Draft 06/01/2009

N-acetylgalactosamine-4-sulfatase mucopolysaccharidosis, type VI (Maroteaux-Lamy syndrome) Positive - Draft 20/02/2009

N-acetylsarcosyl-glycyl-L-valyl-D-allo-isoleucyl-L-threonyl-L-norvalyl-L-isoleucyl-L-arginyl-L-propyl-N-ethylamide soft tissue sarcoma Positive 08/11/2004

N-adamantanyl-N'-Geranyl-ethylenediamine tuberculosis Positive 29/07/2008
[ Nle4, D-Phe7] -alpha-melanocyte stimulating hormone congenital erythropoietic porphyria Positive 29/07/2008

[ Nle4, D-Phe7] -alpha-melanocyte stimulating hormone erythropoietic protoporphyria Positive 29/07/2008

N-methyl D-( 2,3,4,5,6-pentahydroxy-hexyl)-ammonium; 2-(3,5-dichloro-phenyl)-benzoxazole-6-carboxylate familial amyloid polyneuropathy Positive 02/04/2009

N-( methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole malignant gastrointestinal stromal tumours Positive 06/01/2006

N-( methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole mastocytosis Positive 27/10/2005

N-( methyl-diazacyclohexyl-methylbenzamide)-azaphenyl-aminothiopyrrole multiple myeloma Positive 26/07/2005

n-carbamyl-l-glutamic acid n-acetylglutamate synthetase (NAGS) deficiency Positive - Draft 03/03/2009

naptumomab estafenatox renal cell carcinoma Positive 22/01/2008

nelarabine acute lymphoblastic leukemia Positive - Rev 2 29/07/2008

nemorubicin hydrochloride hepatocellular carcinoma Positive 27/10/2005

NGR-human tumour necrosis factor malignant mesothelioma Positive 29/07/2008

nilontib chronic myeloid leukaemia Positive - Rev 1 04/12/2007

nilotinib hydrochloride monohydrate gastrointestinal stromal tumours Positive 29/07/2008

nimotuzamab pancreatic cancer Positive 18/08/2008

nitisinone alkaptonuria Positive - Rev 1 06/01/2003

nitisinone tyrosinaemia type I Positive - Draft 03/03/2009

nolatrexed hepatocellular carcinoma Positive - Rev 1 23/02/2007

octovalent Pseudomonas aeruginosa O-polysaccharide-toxin A conjugate vaccine prevention of Pseudomonas aeruginosa infections in patients with cystic fibrosis Positive - Draft 10/02/2009

ofatumumab chronic lymphocytic leukaemia Positive 02/04/2009

olaparib ovarian cancer Positive 02/07/2008

oligonucleotide phosphorothioate ( TAAACGTTATAACGTTATGACGTCAT), sodium salt glioma Positive 04/01/2006

omigapil maleate congenital muscular dystrophy with merosin (laminin alpha 2) deficiency Positive 29/07/2008

omigapil maleate congenital muscular dystrophy with collagen VI deficiency (Ullrich Syndrome and Bethlem Myopathy) Positive 29/07/2008

opebacan meningococcal disease Positive - Draft Rev 1 10/02/2009

oregovomab ovarian cancer Positive - Rev 3 30/05/2007

Oxalobacter formigenes strain HC-1 primary hyperoxaluria Positive - Draft 27/01/2009

paclitaxel (liposomal) pancreatic cancer Positive 02/04/2009

paclitaxel (micellar) ovarian cancer Positive 02/04/2009

pancreatic enzymes ( cross linked enzyme crystal lipase, protease, amylase) malabsorption due to exocrine pancreatic enzyme insufficiency Positive - Rev 1 18/08/2008

panobinostat lactate cutaneous T-cell lymphoma Positive 22/01/2008

parathyroid hormone ( 1-34) transglutaminase fusion protein fibrin matrix complex solitary bone cysts Positive - Draft 13/01/2009

paromomycin sulfate visceral leishmaniasis Positive 01/07/2005

pazopanib hydrochloride renal cell carcinoma Positive - Draft 20/02/2009

pegvisomant acromegaly Positive - Rev 1 29/11/2005

pegylated arginine deiminase hepatocellular carcinoma Positive 26/07/2005

pegylated L-asparaginase acute lymphoblastic leukaemia Positive - Rev 1 12/03/2009

pegylated recombinant factor VIIa haemophilia A Positive - Rev 1 18/08/2008

pegylated recombinant factor VIIa haemophilia B Positive - Rev 1 18/08/2008

pemetrexed disodium malignant mesothelioma Positive - Draft 03/03/2009

peptide 144 TGF-beta1-inhibitor ( TSLDASIIWAMMQN) localised scleroderma Positive - Rev 1 30/05/2007

peptide 144 TGF-beta1-inhibitor ( TSLDASIIWAMMQN) systemic sclerosis Positive - Rev 1 30/05/2007

phenylephrine hydrochloride ileal pouch anal anastomosis related faecal incontinence Positive - Draft 10/02/2009

picoplatin small-cell lung cancer Positive 02/07/2008

pirfenidone idiopathic pulmonary fibrosis Positive 01/07/2005

polihexanide Acanthamoeba keratitis Positive 02/07/2008

porcine lung surfactant acute lung injury Positive 01/06/2005

porfimer sodium ( for use with photodynamic therapy) cholangiocarcinoma Positive 22/11/2004

porfimer sodium ( for use with photodynamic therapy) high-grade dysplasia in Barrett´s
oesophagus Positive - Rev 3 28/02/2007

pralatrexate non-papillary transitional cell carcinoma of the urinary bladder Positive - Draft 20/02/2009

pralatrexate peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/disseminated) Positive 02/07/2008

prasterone adrenal insufficiency Positive 07/11/2003

pseudomonas exotoxin ( domains II/III) - Interleukin 13 chimeric protein glioma Positive - Rev 2 04/12/2007

purified inactivated Japanese encephalitis SA14-4-2 virus vaccine Japanese encephalitis Positive 24/08/2006

purified bromelain partial deep dermal and full thickness burns Positive - Rev 1 08/01/2003

pyridoxalated hemoglobin polyoxyethylene cardiogenic shock Positive 29/07/2008

R-1-[ 2,3-dihydro-2-oxo-1-pivaloylmethyl-5-(2-pyridyl)-1 H-1,4-benzodiazepin-3-yl]-3-(3-methylaminophenyl)urea gastric carcinoid Positive 19/07/2007

( R)-2-Methyl-6-nitro-2-{ 4-[4-(4-trifluoromethoxyphenoxy)piperidin-1-yl] phenoxymethyl}-2,3-dihydroimidazo[2,1-b]oxazole tuberculosis Positive - Rev 1 10/07/2008

( R)-3-( 4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-1H-pyrazol-1-yl)-3-
cyclopentylpropanenitrile phosphate chronic idiopathic myelofibrosis Positive - Draft 20/02/2009

( R, S)-3-( bromomethyl)-3-butanol-1-yl-diphosphate renal cell carcinoma Positive - Rev 1 30/05/2007

R-salbutamol sulphate cutaneous forms of lupus erythematosus Positive 02/07/2008

ranpirnase malignant mesothelioma Positive - Draft 03/03/2009

recombinant adeno-associated viral vector containing human acid alpha-glucosidase-gene glycogen storage disease type II (Pompe's disease) Positive 04/12/2007

recombinant adeno-associated viral vector containing human alpha-1 antitripsin gene congenital alpha-1 antitrypsin deficiency Positive 19/07/2007

recombinant antibody derivative against human CD19 and CD3 chronic lymphocytic leukaemia Positive 04/01/2006

recombinant antibody derivative against human CD19 and CD3 mantle cell lymphoma Positive 05/11/2004

recombinant derivative of C3 transferase traumatic spinal cord injury Positive - Draft 06/01/2009

recombinant dog gastric lipase cystic fibrosis Positive 29/10/2003

recombinant fusion protein of circularly-permuted IL-4 and pseudomonas exotoxin A, [ IL-4(38-37)-PE38KDEL] glioma Positive - Rev 1 18/08/2008

recombinant fusion protein consisting of the extracellular portion of CD95 fused to the Fc part of a human IgG1 molecule prevention of graft versus host disease Positive 02/04/2009

recombinant fusion protein consisting of human coagulation factor IX attached to the Fc domain of human IgG1 haemophilia B (congenital factor IX deficiency) Positive 29/07/2008

recombinant glycoprotein gp350 of Epstein-Barr virus post-transplantation lympho-proliferative disorders Positive 17/12/2002

recombinant histidine tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors follicular lymphoma Positive 06/01/2006

recombinant histidine tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors mantle cell lymphoma Positive 06/01/2006

recombinant histidine tagged idiotype immunoglobulin Fab fragment of clonal B-cell receptors multiple myeloma Positive 06/01/2006

recombinant human a-mannosidase a-mannosidosis Positive 01/07/2005

recombinant human acid α-glucosidase glycogen storage disease type II (Pompe’s disease) Positive - Draft 17/02/2009

recombinant human acid sphingomyelinase Niemann-Pick disease, type B Positive - Draft 17/02/2009

recombinant human ADAMTS-13 thrombotic thrombocytopenic purpura Positive - Draft 24/02/2009

recombinant human alpha-1 antitrypsin emphysema secondary to congenital alpha-1 antitrypsin deficiency Positive - Rev 3 18/08/2008

recombinant human alpha-1 antitrypsin emphysema secondary to congenital alpha-1 antitrypsin deficiency Positive - Draft 10/02/2009

recombinant human arylsulfatase A metachromatic leukodystrophy Positive - Rev 1 18/08/2008

recombinant human bile salt-stimulated lipase cystic fibrosis Positive 11/10/2005

recombinant human C1-inhibitor angioedema caused by C1 inhibitor deficiency Positive - Draft 10/02/2009

recombinant human C1-inhibitor delayed graft function in organ transplant Positive 04/12/2007

recombinant human CXCL8 mutant delayed graft function after solid organ transplantation Positive 02/04/2009

recombinant human factor XIII ( composed of two A subunits) hereditary factor XIII deficiency Positive - Rev 1 12/12/2005

recombinant human hepatitis C monoclonal antibody against C4 region of E1 for the prevention of recurrent hepatitis C virus induced liver disease in liver transplant recipients Positive 18/08/2008

recombinant human heparan-N-sulfatase mucopolysaccharidosis III, type A (Sanfilippo A syndrome) Positive - Draft 24/02/2009

recombinant human hepatocarcinoma-intestine-pancreas / pancreatic associated protein acute liver failure Positive - Draft 24/02/2009

recombinant human minibody against complement component C5 atypical haemolytic uraemic syndrome (aHUS) associated with an inherited abnormality of the complement system Positive 02/04/2009

recombinant human minibody against complement component C5 fused with RGD-motif ischaemia/reperfusion injury associated with solid organ transplantation Positive - Draft 03/03/2009

recombinant human monoclonal antibody to human IL-1beta of the IgG1/K class systemic-onset juvenile idiopathic arthritis Positive 29/07/2008

recombinant human monoclonal antibody to human IL-1beta of the IgG1/K class cryopirin-associated periodic syndromes(Familial Cold Urticaria Syndrome (FCUS), Muckle-Wells Syndrome (MWS), and Neonatal Onset Multisystem Inflammatory Disease (NOMID), also known as Chronic Infantile Neurological Cutaneous Articular Syndrome (CINCA)) Positive 08/04/2009

recombinant human monoclonal antibody to hsp90 invasive fungal infections Positive - Draft 12/03/2009

recombinant human histone H1. 3 and recombinant human N-bis-met-histone H1.3 acute myeloid leukaemia Positive 10/07/2008

recombinant human insulin-like growth factor-I/recombinant human insulin-like growth factor binding protein-3 leprechaunism Positive - Draft 20/02/2009

recombinant human insulin-like growth factor-I / recombinant human insulin-like growth factor binding protein-3 primary growth hormone insensitivity syndrome (Laron Syndrome) Positive - Rev 2 30/05/2007

recombinant human insulin-like growth factor-I/recombinant human insulin-like growth factor binding protein-3 Rabson Mendnhall syndrome Positive - Draft 20/02/2009

recombinant human insulin-like growth factor-I/recombinant human insulin-like growth factor binding protein-3 Type B extreme insulin resistance syndrome Positive - Draft 20/02/2009
recombinant human interleukin-21 renal cell carcinoma Positive 01/10/2004

recombinant human monoclonal antibody against transforming growth factor beta-1, 2 and 3 idiopathic pulmonary fibrosis Positive 10/07/2008

recombinant human monoclonal antibody to human Nogo-A protein of the IgG4/k class spinal cord injury Positive - Draft 27/01/2009

recombinant human porphobilinogen deaminase acute intermittent porphyria Positive - Rev 1 08/01/2003

recombinant human proinsulin retinitis pigmentosa Positive - Draft 20/03/2009

recombinant human residue 41 glutamic acid to glutamine variant of interferon-alfa-2b Behçet’s disease Positive - Draft 03/03/2009

recombinant human rod-derived cone viability factor retinitis pigmentosa Positive
02/07/2008

recombinant human tissue non-specific alkaline phosphatase - Fc - deca-aspartate fusion protein Corr. hypophosphatasia Positive - Draft 06/01/2009

recombinant human soluble Fc-gamma receptor II b idiopathic thrombocytopenic purpura Positive 29/07/2008

recombinant inhibitor of human plasma kallikrein angioedema Positive 29/01/2003

recombinant megakaryopoiesis-stimulating protein idiopathic thrombocytopenic purpura Positive
29/06/2005

recombinant microbial lipase malabsorption due to exocrine pancreatic enzyme insufficiency Positive 13/03/2006

recombinant modified vaccinia Ankara expressing human 5T4 renal cell carcinoma Positive 04/12/2007

recombinant modified vaccinia virus Ankara expressing tuberculosis antigen 85A
See also Public Statement on Positive Opinion for Tuberculosis Vaccine tuberculosis disease in BCG vaccinated individuals Positive 13/03/2006

recombinant P-selectin glycoprotein immunoglobulin prevention of post transplantation graft dysfunction Positive - Draft 24/02/2009

repertaxin l-lysinate salt prevention of delayed graft function in organ transplant Positive - Draft 10/02/2009

retroviral gamma c cDNA containing vector severe combined immunodeficiency (SCID)-Xl disease Positive - Draft 10/02/2009

ribavirin adenovirus infection in immunocompromised patients Positive - Draft 03/03/2009

ribavirin haemorrhagic fever with renal syndrome Positive - Draft 03/03/2009

ribonucleotide reductase R2 specific phosphorothioate oligonucleotide acute myeloid leukaemia Positive 29/07/2008

rilonacept cryopirin-associated periodic syndromes (Familial Cold Urticaria Syndrome (FCUS), Muckle-Wells Syndrome (MWS), and Neonatal Onset Multisystem Inflammatory Disease (NOMID), also known as Chronic Infantile Neurological Cutaneous Articular Syndrome (CINCA)) Positive 29/07/2008

RNA, [ P-deoxy-P-(dimethylamino)] (2',3'-dideoxy-2',3'-imino-2',3'-seco) (2'a→5') (C-m5U-C-C-A-A-C-A-m5U-C-A-A-G-G-A-A-G-A-m5U-G-G-C-A-m5U-m5U-m5U-C-m5U-A-G), P-[ 4[[2-[2-(2-hydroxyethoxy)ethoxy]ethoxy]carbonyl]-1-piperazinyl] N,N-dimethylaminophosphonamidate Duchenne muscular dystrophy Positive - Draft 12/03/2009

rubitecan pancreatic cancer Positive 23/06/2003

rufinamide Lennox-Gastaut syndrome Positive - Rev 1 28/02/2007

( S)-2-nitro-6-( 4-trifluoromethoxy)benzyloxy)-6,7-dihydro-5H-imidazo[2,1-b] [1,3] oxazine tuberculosis Positive 02/07/2008

sabarubicin small cell lung cancer Positive 06/01/2006

sapacitabine acute myeloid leukaemia Positive - Draft 27/01/2009

sapacitabine myelodysplastic syndromes Positive - Draft 27/01/2009

sapropterin hyperphenylalaninemia Positive 04/01/2006

sarsasapogenin amyotrophic lateral sclerosis Positive 29/07/2008

seocalcitol hepatocellular carcinoma Positive 08/11/2004

sildenafil citrate pulmonary arterial hypertension and chronic thrombormbolic pulmonary hypertension Positive - Rev 1 28/02/2007

sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and

palmitic acid acute lung injury Positive - Rev 3 30/05/2007

sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleyl phosphatidylglycerol and palmitic
acid meconium aspiration syndrome Positive - Rev 1 30/05/2007

sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid respiratory distress syndrome in premature neonates of less than 32 weeks of gestational age Positive 27/10/2005

sinapultide, dipalmitoylphosphatidylcholine, palmitoyl-oleoyl phosphatidylglycerol and palmitic acid respiratory distress syndrome in premature neonates of less than 37 weeks of gestational age Positive 27/10/2005

siplizumab T-cell and NK-cell neoplasms Positive - Draft 27/01/2009

sitaxentan sodium pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Positive - Rev 1 28/02/2007

sodium butyrate (rectal use) radiation proctitis Positive 29/06/2005

sodium dichloroactetate systemic monochloroacetate poisoningsodium Positive 12/12/2005

sodium oxybate narcolepsy Positive - Rev 2 28/02/2007

sodium valproate 5q spinal muscular atrophy Positive 29/11/2005

soluble yeast beta-1,3/1,6- glucan oral mucositis in head and neck cancer patients undergoing radiation therapy Positive 26/06/2005

somatropin AIDS wasting Positive - Draft 03/03/2009

sorafenib tosylate hepatocellular carcinoma Positive - Rev 1 29/07/2008

sorafenib tosylate renal cell carcinoma Positive - Rev 1 28/02/2007

Extract of Sorghum bicolour leaf, Pterocarpus osun stem, Piper guineense seed and Caryophylli flower sickle cell disease Positive 27/10/2005

stiripentol severe myoclonic epilepsy in infancy Positive - Draft 31/07/2007

suberoylanilide hydroxamic acid cutaneous T-cell lymphoma Positive 11/10/2005

sudismase active phase of Peyronie's disease Negative 27/10/2005

sulfonated monophosphorylated mannose oligosaccharide hepatocellular carcinoma Positive - Draft 29/07/2008

tacrolimus hydrate vernal keratoconjunctivitis Positive 26/04/2004

talactoferrinum alpha renal cell carcinoma Positive 19/07/2007

tazarotene congenital ichthyoses Positive 02/04/2009

tegafur, gimeracil, oteracil potassium gastric cancer Positive 29/07/2008

temocillin sodium Burkholderia cepacia lung infection in cystic fibrosis Positive 23/09/2004

temsirolimus mantle cell lymphoma Positive 02/04/2009

temsirolimus renal cell carcinoma Positive 02/04/2009

terguride pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Positive 29/07/2008

tetrahydrobiopterin hyperphenylalaninemia Positive - Rev 3 18/08/2008

TGF-ß2-specific phosphorothioate antisense oligodeoxynucleotide high-grade glioma Positive - Rev 1 08/01/2003

thalidomide serythema nodosum lepra or type II lepra reaction Positive - Draft 20/02/2009

thalidomide erythema nodosum leprosum (ENL) or type II lepra reactions Positive - Draft 10/02/2009

thalidomide graft-versus-host disease Positive - Rev 2 13/12/2007

thalidomide multiple myeloma Positive (Laboratoires Laphal) - Rev 2 13/12/2007

thalidomide multiple myeloma Positive (Kendle International Limited) 11/10/2005

thalidomide multiple myeloma Positive (Pharmion Ltd) - Rev 1 29/07/2008

thiotepa conditioning treatment prior to haematopoietic progenitor cell transplantation
Positive 19/07/2007

thymalfasin hepatocellular carcinoma Positive - Rev 1 08/01/2003

tilarginine acetate cardiogenic shock Positive 08/08/2006

tipifarnib acute myeloid leukaemia Positive 01/06/2005

titanium dioxide and bisoctrizole UV-A and visible light-induced photosensitivity disorders (chronic actinic dermatitis, cutaneous porphyrias, actinic prurigo and solar urticaria) Positive 01/07/2005

tobramycin (inhalation powder) Pseudomonas aeruginosa lung infection in cystic fibrosis Positive - Rev 1 07/03/2007

tobramycin (inhalation use) Pseudomonas aeruginosa lung infection in cystic fibrosis Positive - Draft 12/03/2009

tobramycin (liposomal) Pseudomonas aeruginosa lung infection in cystic fibrosis Positive - Draft 27/01/2009

topotecan hydrochloride ( liposomal) glioma Positive - Draft 13/01/2009

tositumomab follicular lymphoma Positive - Rev 1 12/12/2005

tramadol hydrochloride painful HIV-associated neuropathy Negative 19/07/2007

trabectedin ovarian cancer Positive 01/10/2004

treosulfan conditioning treatment prior to haematopoietic progenitor cell transplantation Positive 22/11/2004

treprostinil diethanolamine ( oral use) pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Positive 29/11/2005

treprostinil sodium ( inhalation use) pulmonary arterial hypertension and chronic
thromboembolic pulmonary hypertension Positive - Rev 1 18/08/2008

tretazicar visceral leishmaniasis Positive 10/07/2008

trientine dihydrochloride Wilson’s disease Positive 26/04/2004

troxacitabine acute myeloid leukaemia Positive - Rev 2 29/07/2008
type I native bovine skin collagen systemic sclerosis Positive - Draft 03/03/2009

Val-Leu-Gln-Glu-Leu-Asn-Val-Thr-Val ( Pr1 nanopeptide, sequence 169-177, of proteinase 3) acute myeloid leukaemia Positive 06/01/2006

Val-Leu-Gln-Glu-Leu-Asn-Val-Thr-Val ( Pr1 nanopeptide, sequence 169-177, of proteinase 3) chronic myeloid leukaemia Positive 06/01/2006

Val-Leu-Gln-Glu-Leu-Asn-Val-Thr-Val ( Pr1 nanopeptide, sequence 169-177, of proteinase 3) myelodysplastic syndromes Positive 06/01/2006

vandetanib medullary thyroid carconoma Positive 08/08/2006

valproic acid, sodium familial adenomatous polyposis Positive 04/01/2006

vascular endothelial growth factor-D gene in an adenoviral vector for use with a collagen collarf or the prevention of stenosis in synthetic grafts used in haemodialysis Positive 06/12/2004

vasoactive intestinal peptide pulmonary arterial hypertension and chronic thromboembolic pulmonary hypertension Positive - Rev 1 30/05/2007

vincristine sulphate liposomes acute lymphoblastic leukaemia Positive - Draft 13/01/2009

xaliproden hydrochloride amyotrophic lateral sclerosis Positive - Draft 12/03/2009

Yttrium ( 90Y) antiferritin polyclonal antibodies Hodgkin lymphoma
Positive - Rev 1 30/05/2007

yttrium ( 90Y)-DOTA-radiolabelled humanized monoclonal antibody against mucin 1 pancreatic cancer Positive - Draft 20/02/2009

yttrium ( 90Y) edotreotide gastro-entero-pancreatic neuroendocrine tumours Positive - Draft 06/01/2009

zanolimumab peripheral T-cell lymphoma (nodal, other extranodal and leukaemic/ disseminated) Positive - Rev 1 18/08/2008

ziconotide (intraspinal use) chronic pain requiring intraspinal analgesia Positive 19/07/2007

zinc acetate dihydrate Wilson's disease Positive - Draft 03/03/2009

zosuquidar trihydrochloride acute myeloid leukaemia Positive - Draft 13/01/2009
( Z)-N-[ 2-(Diethylamino)ethyl]-5-[(5-fluoro-2-oxo-1,2-dihydro-3H-indol-3-ylidene)methyl]-2,4-
dimethyl-1H-pyrrole-3-carboxamide (S)-2-hydroxysyccinate malignant gastrointestinal stromal tumours Positive - Rev 1 28/02/2007

( Z)-N-[ 2-(Diethylamino)ethyl]-5-[(5-fluoro-2-oxo-1,2-dihydro-3H-indol-3-ylidene)methyl]-2,4-dimethyl-1H-pyrrole-3-carboxamide (S)-2-hydroxysyccinate renal cell carcinoma Positive - Rev 1 28/02/2007
© 1995-2008 EMEA | Page last updated: 24 April, 2009