Saffold Cardiovirus in Children | CDC EID

Volume 15, Number 9–September 2009
Dispatch
Saffold Cardiovirus in Children with Acute Gastroenteritis, Beijing, China
Lili Ren, Richard Gonzalez, Yan Xiao, Xiwei Xu, Lan Chen, Guy Vernet, Gláucia Paranhos-Baccalà, Qi Jin, and Jianwei Wang
Author affiliations: State Key Laboratory for Molecular Virology and Genetic Engineering, Beijing, People's Republic of China (L. Ren, Q. Jin, J. Wang); Institute of Pathogen Biology, Beijing (L. Ren, R. Gonzalez, Y. Xiao, L. Chen, Q. Jin, J. Wang); Fondation Mérieux, Lyon, France (R. Gonzalez, G. Vernet, G. Paranhos-Baccalà); and Beijing Children's Hospital, Beijing (X. Xu)

Suggested citation for this article

Abstract
To understand Saffold cardiovirus (SAFV) distribution, prevalence, and clinical relevance in China, we retrospectively studied SAFV in children with acute gastroenteritis and found SAFV in 12 (3.2%) of 373. Sequence homology of virus protein 1 genes suggested these strains belong to the SAFV-1 sublineage. SAFVs were found in samples positive for other diarrhea-causing viruses.

Recently, a new virus, provisionally named Saffold virus (SAFV), was recovered in the United States from a fecal sample from an 8-month-old girl with fever of unknown origin (1). The newly identified virus was classified under the genus Cardiovirus, family Picornaviradae. The 2 known species of the genus Cardiovirus, encephalomyocarditis viruses and Theiler viruses (2), are known to be pathogenic in several animal species and in humans (3–6). SAFV is genetically related to Theiler viruses and is believed to constitute a novel cardiovirus species (1,7). SAFV has been detected in children with enteric or respiratory tract infections in the United States, Canada, Brazil, Germany, Pakistan, and Afghanistan (1,8–11). However, the worldwide distribution of SAFV and its clinical significance remain unclear. To understand SAFV distribution, prevalence, and clinical relevance in the People's Republic of China, we conducted a retrospective study by screening for SAFV in children with acute gastroenteritis.

The Study
From March 2006 through November 2007, fecal samples were collected from 373 pediatric outpatients at Beijing Children's Hospital in a prospective study on viral etiology of diarrhea. The ages of patients ranged from 1 month to 13 years (mean age 11.7 months, median age 9.0 months). Gastroenteritis was defined as acute watery diarrhea accompanied by other clinical signs and symptoms such as fever, nausea, and vomiting. No patient had any apparent clinical respiratory signs or symptoms.

We diluted these previously collected fecal specimens to 10% (wt/vol) with phosphate-buffered saline (pH 7.2) and removed cellular debris by centrifugation (2,500× g for 5 min). Virus nucleic acids were extracted by using the NucliSens miniMAG platform according to the manufacturer's instructions (bioMérieux, Marcy l'Etoile, France). SAFV RNA was detected in the samples by nested reverse transcription–PCR (RT-PCR) that used primers targeting the 5´ untranslated region (UTR), which generated a 540-bp amplicon (9). Primers cardioVP1-1F/4R and cardioVP1-2F/3R, which span the virus protein 1 (VP1) gene, were used for a nested RT-PCR to amplify the VP1 gene (about 910 bp) as previously described (10). Because VP1 genes of 2 SAFV-positive samples could not be amplified in this way, a newly designed primer pair (cardioVP1Fn: TCAGAATGCCAATCTCCCCAAC and cardioVP1Rn: AAAGGTCCACCCGATACATTGA) was used in combination with cardioVP1-2F/3R to amplify the VP1 gene based on the sequences obtained from our positive samples. Conditions for first- and second-round PCR were 94°C for 3 min, followed by 40 cycles of 94°C for 30 sec, 48°C for 30 sec, and 72°C for 90 sec, and a final 10-min cycle at 72°C. All positive PCR amplicons were verified by sequencing after being cloned into the pMD18T vector (Takara Bio Inc., Dalian, China). Three positive clones were randomly selected for parallel sequencing. Each sample was screened by PCR for enteric adenovirus, astrovirus, noroviruses, sapovirus, and human bocavirus by using PCR (12,13) and for group A rotaviruses by using the Rotavirus ELISA Diagnostic Kit (Lanzhou Institute for Biological Products, Lanzhou, China). To characterize the nucleotide sequences obtained from this study, we analyzed the 5´ UTR and VP1 genes of all SAFV isolates to determine the extent of homology among the genes and those documented in the GenBank database by using MEGA software (14).

SAFV RNA was detected in 12 (3.2%) of 373 fecal specimens by using RT-PCR with primers targeting the 5´ UTR gene. Of these 12 positive specimens, 5 were collected from boys and 7 from girls. The ages of SAFV-positive patients ranged from 1 month to 3 years (mean age 12.3 months, median age 9.5 months). This age distribution is similar to that reported by Chiu et al., who detected SAFV mainly in younger children (10).

Co-infections with other viruses, including rotavirus (7/11) and norovirus (5/11), were detected in 11/12 SAFV-positive specimens (Table). The prevalence of rotavirus and norovirus infection in this sample pool was 59.5% (222/373) and 12.1% (45/373), respectively. SAFV-positive samples were found only in the last month of the 18-month study period, November 2007.

Figure

Figure. Phylogenetic analysis of nucleotide sequences of the virus protein 1 (VP1) gene of Saffold cardiovirus...

To assess the sequence variations of SAFV strains detected in this study, we analyzed an 825-bp cDNA fragment (GenBank accession nos. FJ464766–FJ464777) corresponding to the VP1 gene of the 12 SAFV strains. Previous studies have demonstrated the existence of 8 distinct phylogenetic sublineages of SAFV on the basis of the homology of P1 and VP1 genes (9,11). However, all strains identified in this study appeared to be the SAFV-1 sublineage (Figure), and they showed 99.2%–100% homology in nucleotide sequences and 98.5%–100% homology in the amino acid sequence of the VP1 gene. The identity of the VP1 amino acid sequences among these strains and the prototype SAFV (EF165067) was as high as 98.1%–98.9%. Multiple-alignment analysis showed that the amino acid sequence identity of VP1 among all available isolates varied from 62.3% to 100% (Appendix Table), indicating the global diversity of the SAFV strains from different geographic locations.

Conclusions
This retrospective study showed that 12 (3.2%) of 373 children with acute gastroenteritis in Beijing were SAFV-positive, indicating the prevalence of recently characterized SAFV in China and providing evidence of global distribution of SAFV. Although SAFVs have been detected in samples collected from enteric and respiratory tracts, the clinical role for SAFV is still unclear. In this study, 11 of 12 SAFV-positive samples were co-infected with at least 1 known diarrhea-causing virus, such as rotavirus or norovirus. Therefore, we cannot conclusively state that SAFV is responsible for gastroenteritis (8–11).

That all SAFV-positive samples were collected in November 2007 suggests a possible seasonal outbreak. However, because of insufficient background information from outpatients, whether the rate of SAFV detection peaks in a single month or whether it indicates a seasonal outbreak is unclear. Further investigations are necessary. Nevertheless, our finding suggests a potential epidemic of SAFV during the cold season (9).

In the samples used for this study, we detected SAFV-1 only, no other sublineages (9,11). Although isolated 20 years ago in San Diego, California, USA, the SAFV-1 sequence was not published until 2007 because of the progress of molecular techniques for unknown genome cloning (1). The reason for this 20-year hiatus of SAFV-1 in the United States and the occurrence of the same genotype in China in 2007 is unclear. It can be attributed to a geographic variation of an SAFV epidemic in the world. Currently, 8 SAFV sublineages have been identified in different areas: SAFV-2 and SAFV-3 have been detected in North and South America (United States and Brazil) and Europe (9,10), and SAFV-2 to SAFV-8 have been detected in South Asia (11). SAFV-1 may be the dominant sublineage in circulation in Beijing and may have escaped detection until the current investigation. The dominant SAFV sublineages may be changing over time in a certain geographic area. An SAFV-1 endemic to the United States in the1980s may have been subsequently replaced by SAFV-2 and SAFV-3, whereas SAFV-1 has now become dominant in Beijing. Because the existence of these human Theiler-like viruses was unknown before 2007, comprehensive global investigations of the prevalence and diversity of SAFV, especially studies based on samples collected over the previous years, will be helpful in providing further insights into SAFV origin, sublineage, and distribution.

Acknowledgments
We thank Li Guo for her assistance with verifying PCR results. We also thank Yongjun Li for his assistance with sequence analysis.

This study was supported in part by grants from National Science Research Megaproject against Major Infectious Diseases in China (2009ZX10004-206); Fondation Mérieux; and Institute of Pathogen Biology, Chinese Academy of Medical Sciences.

Dr Ren is a scientist working at the Institute of Pathogen Biology. Her research activities are focused on the etiology and pathogenesis of respiratory viruses.

References
Jones MS, Lukashov VV, Ganac RD, Schnurr DP. Discovery of a novel human picornavirus in a stool sample from a pediatric patient presenting with fever of unknown origin. J Clin Microbiol. 2007;45:2144–50. PubMed DOI
Stanway G, Brown F, Christian P, Hovi T, Hyypiä T, King AMQ, et al. Family Picornaviridae. In: Fauquet CM, Mayo MA, Maniloff J, Desselberger U, Ball LA, editors. Virus taxonomy: eighth report of the International Committee on Taxonomy of Viruses. London: Elsevier/Academic Press; 2005. p. 757–78.
LaRue R, Myers S, Brewer L, Shaw DP, Brown C, Seal BS, et al. A wild-type porcine encephalomyocarditis virus containing a short poly (C) tract is pathogenic to mice, pigs, and cynomolgus macaques. J Virol. 2003;77:9136–46. PubMed DOI
Knowles NJ, Dickinson ND, Wilsden G, Carra E, Brocchi E, De Simone F. Molecular analysis of encephalomyocarditis viruses isolated from pigs and rodents in Italy. Virus Res. 1998;57:53–62. PubMed DOI
Grobler DG, Raath JP, Braak LE, Keet DF, Gerdes GH, Barnard BJ, et al. An outbreak of encephalomyocarditis-virus infection in free-ranging African elephants in the Kruger National Park. Onderstepoort J Vet Res. 1995;62:97–108.
Kirkland PD, Gleeson AB, Hawkes RA, Naim HM, Boughton CR. Human infection with encephalomyocarditis virus in New South Wales. Med J Aust. 1989;151:176–8.
Liang Z, Kumar AS, Jones MS, Knowles NJ, Lipton HL. Phylogenetic analysis of the species Theilovirus: emerging murine and human pathogens. J Virol. 2008;82:11545–54. PubMed DOI
Abed Y, Boivin G. New Saffold cardioviruses in 3 children, Canada. Emerg Infect Dis. 2008;14:834–6. PubMed DOI
Drexler JF, Luna LK, Stöcker A, Almeida PS, Ribeiro TC, Petersen N, et al. Circulation of 3 lineages of a novel Saffold cardiovirus in humans. Emerg Infect Dis. 2008;14:1398–405 PubMed DOI
Chiu CY, Greninger AL, Kanada K, Kwok T, Fischer KF, Runckel C, et al. Identification of cardioviruses related to Theiler's murine encephalomyelitis virus in human infections. Proc Natl Acad Sci U S A. 2008;105:14124–9. PubMed DOI
Blinkova O, Kapoor A, Victoria J, Jones M, Wolfe N, Naeem A, et al. Cardioviruses are genetically diverse and common enteric infections in south Asian children. J Virol. 2009;83:4631–41. PubMed DOI
Rohayem J, Berger S, Juretzek T, Herchenröder O, Mogel M, Poppe M, et al. A simple and rapid single-step multiplex RT-PCR to detect norovirus, astrovirus and adenovirus in clinical stool samples. J Virol Methods. 2004;118:49–59. PubMed DOI
Chung JY, Han TH, Kim CK, Kim SW. Bocavirus infection in hospitalized children, South Korea. Emerg Infect Dis. 2006;12:1254–6.
Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596–9. PubMed DOI
Figure
Figure. Phylogenetic analysis of nucleotide sequences of the virus protein 1 (VP1) gene of Saffold cardiovirus...

Tables (please, see the full-text)
Table. Fecal samples positive for Saffold cardiovirus, Beijing, People's Republic of China, March 2006–November 2007
Appendix Table. Amino acid and nucleotide acid sequence identities of VP1 sequences between SAFV strains, Beijing, People’s Republic of China, March 2006–November 2007

Suggested Citation for this Article
Ren L, Gonzalez R, Xiao Y, Xu X, Chen L, Vernet G, et al. Saffold cardiovirus in children with acute gastroenteritis, Beijing, China. Emerg Infect Dis [serial on the Internet]. 2009 Sep [date cited]. Available from http://www.cdc.gov/EID/content/15/9/1509.htm

DOI: 10.3201/eid1509.081531

abrir aquí para acceder al documento CDC completo:
Saffold Cardiovirus in Children | CDC EID

Rhinovirus C and Apparently Life-Threatening Events | CDC EID

Volume 15, Number 9–September 2009
Dispatch
Role of Rhinovirus C in Apparently Life-Threatening Events in Infants, Spain
Cristina Calvo, M. Luz García, Francisco Pozo, Noelia Reyes, Pilar Pérez-Breña, and Inmaculada Casas
Author affiliations: Hospital Severo Ochoa, Leganés, Madrid, Spain (C. Calvo, M.L. García); and National Center for Microbiology, Institute of Health Carlos III, Madrid (F. Pozo, N. Reyes, P. Pérez-Breña, I. Casas)

Suggested citation for this article

Abstract
To assess whether infants hospitalized after an apparently life-threatening event had an associated respiratory virus infection, we analyzed nasopharyngeal aspirates from 16 patients. Nine of 11 infants with positive virus results were infected by rhinoviruses. We detected the new genogroup of rhinovirus C in 6 aspirates.

Human rhinovirus (HRV) is 1 of the most common agents associated with upper and lower respiratory tract infections in children and infants (1) and is a major trigger of asthma exacerbations (2). Recently, molecular methods have shown substantial phenotypic variation of HRV and identified a novel HRV genogroup provisionally named HRV-C (3). Severe asthma exacerbations in children have been associated with this new genogroup of rhinoviruses. Genogroup C could be resistant to a new candidate group of antipicornavirus drugs, including pleconaril (4).

Apparently life-threatening events (ALTEs) in infants are associated with bronchiolitis or infections in up to 6% of patients by diagnosis after hospital admission (5). We assessed the relation between ALTEs and respiratory virus infection in a secondary hospital in Spain.

The Study
Our study was part of a systematic prospective study to assess the epidemiology of respiratory virus infections in children admitted to the Severo Ochoa Hospital (Leganés, Madrid Province, Spain).We conducted a specific study to determine the incidence of respiratory virus infections in all infants admitted after ALTEs during November 2004–December 2008. An ALTE in a child <1 year of age was defined as an episode that is frightening to the observer and characterized by some combination of apnea, color change, marked change in muscle tone, choking, or gagging so the observer fears the infant has died (6).

Nasopharyngeal aspirate (NPA) specimens were acquired from each eligible patient at the time of hospital admission (on Monday–Friday). Samples were sent for virologic study to the Influenza and Respiratory Virus Laboratory (National Centre for Microbiology, Institute of Health Carlos III, Spain). Specimens were processed within 24 hours after collection.

Total nucleic acids were extracted from 200-μL aliquots by using a QIAamp MinElute Virus Spin Kit in a QIAcube automated extractor (QIAGEN, Valencia, CA, USA). Simple or multiplex reverse transcription–nested PCR assays (RT-PCR) previously described (7–9) were used to assess the virus diagnosis, including 16 respiratory viruses or groups of viruses. Degenerated primers for HRV and enteroviruses were designed between the 3´ end of the 5´ noncoding region (NCR) and the viral protein (VP) 4/VP2 polyprotein gene (TCIGGIARYTTCCASYACCAICC-3´ and CTGTGTTGAWACYTGAGCICCCA-3´). HRVs from positive samples were identified by sequencing and phylogenetic analysis of these sequences. Amplified products (about 500 bp, depending on HRV serotype) were purified and sequenced in both directions by using an automated ABI PRISM 377 model sequencer. Partial sequences of HRV have been submitted to GenBank (accession nos. FJ841954–FJ841957, FJ841959–FJ841961, EU697826, and EU697832). Appropriate precautions were implemented to avoid false-positive results by carryover contamination. Positive results were confirmed by testing a second aliquot of the sample stored at –70ºC.

Sixteen infants (8 of each sex) were enrolled in the study. All patients were <5 months of age (range 7 days–5 months, mean age 7.6 weeks, median 4 weeks). Twelve infants had rhinorrea, cough, and distress signs (Table). A total of 11 (69%) NPA specimens were positive for at least 1 viral agent. For 9 of these patients, positive results for HRV were confirmed, and for the other 2 patients, respiratory syncytial virus was detected.

Figure

Figure. Phylogenetic analysis of 5´ noncoding region and viral protein (VP) 4/2 coding region of 9 human rhinoviruses (HRVs)...

Phylogenetic analyses of 9 sequences obtained from patients showed distribution of HRV in 3 clusters. Three sequences were included in previously characterized clades, defined by HRV group A (HRV-A, SO4923–EU697826) and B (HRV-B, SO3970–FJ841954 and SO4998–EU697832). Sequence from patient SO4923 had a low sequence similarity with the other serotypes of HRV-A. In contrast, sequences from patients SO3970 and SO4998 were closely related to HRV-35 and HRV-79, respectively. Six sequences were included in the third group corresponding to the new HRV-C: SO5854, SO6666, SO5797, SO6819, SO5986, SO6813- FJ841955-57 and FJ841959-61) (3,10) (Figure). Different genotypes (collectively called HRV-Cs) were identified in 6 NPA specimens from children with ALTEs (67% of total HRV). Two received cardiopulmonary resuscitation at home; for these 2 patients, a respiratory syncytial virus and an HRV-C were identified. All 16 children survived.

Conclusions
The most common discharge diagnoses reported for ALTEs are gastroesophageal reflux disease (GERD), unknown causes, seizures, and lower respiratory tract infections (11). Our series suggests that ALTEs of previously unknown etiology could be related to HRV infections. Rhinovirus infections are known to be a major cause of illness and hospital admission for young children, particularly infants <2 years of age (12). Detection of viral genomes by nested RT-PCR in NPA specimens led us to analyze the effect of HRV infections in different clinical situations. Respiratory infections associated with HRV might play a major role in young infants, probably with few clinical signs, and might contribute to apnea as a first manifestation. GERD is the most frequent hospital discharge diagnosis in published series (5,11). For our patients, GERD also was the most frequent clinical diagnosis (9 patients), but for 7 of them, a respiratory virus was identified. We cannot conclude whether GERD is a risk factor for apnea or whether signs are so nonspecific that diagnoses could be confused.

Alternatively, the new HRV-C group could account for as many as a quarter or even half of HRV infections (4,13). In children, it has been associated with bronchiolitis, wheezing, and asthma exacerbations severe enough to require hospitalization; the percentage of these children with hypoxia was substantial (13). In a case–control study, Khetsuriani et al. (4) found HRV-C only in case-patients, supporting the pathogenic role of this genogroup. They considered that HRV-C infections could be associated with more severe clinical manifestations than infections with other HRV genogroups A and B. These data could also support the role of HRV-C in infants with ALTEs found in this work.

Although we had no control group for our patients, we recently published a study of a cohort of 316 newborns up to 6 months of age tested weekly for respiratory diseases (mainly upper respiratory tract infections), coincident in age and time with our patients (14). HRV was present in 5 (3.6%) of 72 infants tested. Two viruses were genetically identified as HRV-C, demonstrating they form distinct genetic clusters, and no genetic similarity was obtained with the ALTE–related HRV-C viruses. In addition, a second group of asymptomatic children of different ages but in coincident epidemic seasons was studied. The group of children with HRV was substantially smaller than the group of children with respiratory disease (15).

Viral infections could play a major role in ALTEs. Rhinoviruses, especially HRV-C, could cause a respiratory infection with few symptoms in young infants and could trigger ALTEs in this age group. Therefore, HRVs and posterior genotyping should be included in studies of the etiology of ALTEs to help identify the true relevance of HRV-C infection to these episodes.

Acknowledgments
We thank Lola Lopez-Valero, Nieves Cruz, Monica Sánchez, and Ana Calderón for technical assistance.

This work was supported by grant PI060532 by Fondo de Investigaciones Sanitarias, Institute of Health Carlos III. Research on viral respiratory infections is carried out in collaboration with the Influenza and Respiratory Viruses Laboratory at the National Center of Microbiology (ISCIII) and supported by the Health Research Fund.

Dr Calvo is chief clinician of pediatrics at Hospital Severo Ochoa, Leganés, Madrid, Spain. Her research interests include infectious diseases in children.

References
Kusel MMH, Klerk NH, Holt PG, Kebadze T, Johnston SL, Sly P. Role of respiratory viruses in upper and lower respiratory tract illness in the first year of life. A birth cohort study. Pediatr Infect Dis J. 2006;25:680–6. PubMed DOI
Lemanske RF Jr, Jackson DJ, Gangnon RE, Evans MD, Li Z, Shult PA, et al. Rhinovirus illnesses during infancy predict subsequent childhood wheezing. J Allergy Clin Immunol. 2005;116:571–7. PubMed DOI
Lamson D, Renwick N, Kapoor V, Liu Z, Palacios G, Ju J, et al. MassTag polymerase-chain-reaction detection of respiratory pathogens, including a new rhinovirus genotype, that caused influenza-like illness in New York State during 2004–2005. J Infect Dis. 2006;194:1398–402. PubMed DOI
Khetsuriani N, Lu X, Teague WG, Kazerouni N, Aderson LJ, Erdman DD. Novel human rhinoviruses and exacerbation of asthma in children. Emerg Infect Dis. 2008;14:1793–6. PubMed DOI
Bonkowsky JL, Guenther E, Filloux FM, Srivastava R. Death, child abuse and adverse neurological outcome of infants after apparent life-threatening event. Pediatrics. 2008;122:125–31. PubMed DOI
National Institutes of Health Consensus Development Conference on Infantile Apnea and Home Monitoring, Sep 29 to Oct 1, 1986. Pediatrics. 1987;79:292–9.
Pozo F, García-García ML, Calvo C, Cuesta I, Pérez-Breña P, Casas I. High incidence of human bocavirus infection in children in Spain. J Clin Virol. 2007;40:224–8. PubMed DOI
Coiras MT, Aguilar JC, Garcia ML, Casas I, Perez-Brena P. Simultaneous detection of fourteen respiratory viruses in clinical specimens by two multiplex reverse transcription nested-PCR assays. J Med Virol. 2004;72:484–95.
López-Huertas MR, Casas I, Acosta-Herrera B, Garcia ML, Coiras MT, Pérez-Breña P. Two RT-PCR based assays to detect human metapneumovirus in nasopharyngeal aspirates. J Virol Methods. 2005;129:1–7. PubMed DOI
Briese T, Renwick N, van den Berg M, Jarman R, Ghosh D, Köndgen S, et al. Role of rhinovirus in hospitalized infants with respiratory tract infections in Spain. Emerg Infect Dis. 2008;14:944–7. PubMed DOI
McGovern MC, Smith MB. Causes of apparent life threatening events in infants: a systematic review. Arch Dis Child. 2004;89:1043–8. PubMed DOI
Calvo C, García-García ML, Blanco C, Pozo F, Casas I, Perez-Breña P. Rhole of rhinovirus in hospitalized infants with respiratory tract disease in Spain. Pediatr Infect Dis J. 2007;26:904–8. PubMed DOI
Miller EK, Edwards KM, Weinberg GA, Iwane MK, Griffin MR, Hall CB et al. A novel group of rhinoviruses is associated with asthma hospitalizations. J Allergy Clin Immunol. 2009;123:105–6.
Bueno Campaña M, Calvo Rey C, Vázquez Alvarez MC, Parra Cuadrado E, Molina Amores A, Rodrigo García G, et al. Infecciones virales de vías respiratorias en los primeros 6 meses de vida. An Pediatr (Barc). 2008;69:400–5. PubMed DOI
García-García ML, Calvo C, Pozo F, Pérez-Breña P, Quevedo S, Bracamonte T, et al. Human bocavirus detection in nasopharyngeal aspirates of children without clinical symptoms of respiratory infection. Pediatr Infect Dis J. 2008;27:358–60. PubMed DOI
Figure
Figure. Phylogenetic analysis of 5´ noncoding region and viral protein (VP) 4/2 coding region of 9 human rhinoviruses (HRVs)...

Table (please, see the full-text)
Table. Characteristics of infants with ALTEs, Spain, November 2004–December 2008

Suggested Citation for this Article
Calvo C, García ML, Pozo F, Reyes N, Pérez-Breña P, Casas I. Role of rhinovirus C in apparently life-threatening events in infants, Spain. Emerg Infect Dis [serial on the Internet]. 2009 Sep [date cited]. Available from http://www.cdc.gov/EID/content/15/9/1506.htm

DOI: 10.3201/eid1509.090453

ABRIR AQUÍ para acceder al documento CDC completo:
Rhinovirus C and Apparently Life-Threatening Events | CDC EID

Replication of HBoV-2 in Respiratory Tract | CDC EID

Volume 15, Number 9–September 2009
Dispatch
Absence of Detectable Replication of Human Bocavirus Species 2 in Respiratory Tract
Thaweesak Chieochansin, Amit Kapoor, Eric Delwart, Yong Poovorawan, and Peter Simmonds
Author affiliations: Chulalongkorn University and Hospital, Bangkok, Thailand (T. Chieochansin, Y. Poovorawan), University of California, San Francisco, California, USA (A. Kapoor, E. Delwart); and University of Edinburgh, Edinburgh, Scotland, UK (P. Simmonds)

Suggested citation for this article

Abstract
Human bocavirus (HBoV) commonly infects young children and is associated with respiratory disease; disease associations of the divergent HBoV-2 species are unknown. Frequent HBoV-2 detection in fecal samples indicated widespread circulation in the United Kingdom and Thailand, but its lack of detection among 6,524 respiratory samples indicates likely differences from HBoV-1 in tropism/pathogenesis.

Since its discovery in 2005 (1), human bocavirus (HBoV) has been the subject of intense investigation as a potential cause of human respiratory disease (2). In addition to respiratory tract and systemic infections, HBoV DNA sequences are frequently detected in fecal samples during primary infections (3,4), although a causative role in viral gastroenteritis has not been established (5–7). Other parvoviruses, including canine and bovine members of the genus Bocavirus, can replicate in the gastrointestinal tract and are often linked to enteric disease (8,9).

Until recently, published genetic analyses reported minimal sequence variability of HBoV strains; 2 genetic lineages differed in nucleotide sequence by only 2% in the virus protein 2 (VP2) gene (10). However, more divergent HBoV-like variants, provisionally designated as HBoV species 2 (HBoV-2), have been identified in fecal samples from children in Pakistan and the United Kingdom. These viruses show >20% nt sequence divergence (11). Published primer sequences for HBoV contain several mismatches with HBoV-2 sequences that may prevent their amplification (11). Thus, published surveys of HBoV prevalence likely report only HBoV-1. Therefore, HBoV-2 may represent an additional, currently undetected, agent in respiratory or enteric disease.

The Study
To investigate HBoV-2, we developed new PCR-based detection methods for HBoV by using primer sets highly conserved between HBoV-1 and HBoV-2 and species-specific primers for HBoV-2. Large-scale screening of persons in the United Kingdom and Thailand was performed to compare virus detection frequencies in respiratory and fecal samples.

A total of 6,138 respiratory samples from 3,754 persons (2,018 male, 1,722 female, 14 sex unknown) during January 1, 2007–June 30, 2008, were obtained from the Specialist Virology Centre (Edinburgh, UK). Samples were not identified but epidemiologic and demographic information was retained (12,13). Samples comprised 3,065 nasopharyngeal swabs/aspirates (NPAs) and throat swabs (83%). A total of 386 NPAs were obtained from 386 persons (229 male, 154 female, 3 sex unknown) in Bangkok during February 16, 2006–July 20, 2008.

A total of 2,500 fecal samples were obtained from patients (1,093 male, 1,398 female, and 9 sex unknown) in Edinburgh predominantly with gastroenteritis or other enteric diseases referred for bacteriologic screening during March, June, and September 2008. A total of 530 fecal samples were obtained predominantly from children (179 boys and 138 girls) <5 years of age with diarrhea during July 12, 2007–July 25, 2008, and a control group without diarrhea (116 male, 96 female, 1 sex unknown) during March 4–December 2, 2007, in Bangkok.

DNA was extracted from 200-μL samples of pooled or individual specimens (respiratory samples, clarified fecal supernatant) into 40 μL Tris-EDTA buffer as described (13). Respiratory and fecal samples from Edinburgh were screened in pools of 10; both sample types from Bangkok were screened individually. Screening was performed by using nested primers conserved between HBoV-1 and HBoV-2 in the nucleoprotein (NP)–1 gene (universal primers: outer sense [position 2589 in DQ000496 st2 isolate (1)]: 5´-CCWATCGTCYTSYACTGCTTYGA-3´; outer antisense [2980]: 5´-TAGCYAAGTGTYTWBKGTACACATYAT-3´); inner sense [2727]: 5´-RTKSTGYGGBTTCTAYTGGCA-3´; and inner antisense [2963]: 5´-TACACATCATCCCARTAAYWACAT-3´).

Amplication conditions were 94°C for 2 min and 35 cycles at 94°C for 18 s, 50°C for 21 s, and 72°C for 1.5 min. Amplicons were differentiated by digestion with RsaI. Fragments were sized by agarose gel electrophoresis. All known HBoV-1 sequences contain an RsaI site between nt 2772 and nt 2773, resulting in fragments of 46 bp and 91 bp; this site is absent in HBoV-2 (undigested amplicon length of 237 bp).

Each pool or sample was additionally screened by using HBoV2-specific primers located in the nonstructural (NS)–1 gene (outer sense [1484]: 5´-AACAGATGGGCAAGCAGAAC-3´; outer antisense [2031]: 5´-AGGACAAAGGTCTCCAAGAGG-3´; inner sense [1618]: 5´-AACGATTGCAGACAACGCCTTATA-3´; and inner antisense [2019]: 5´-TCCAAGAGGAAATGAGTTTGG-3´; sites matching all known HBoV-2 variants and not matching HBoV-1 variants are underlined.) Amplification conditions were 95°C for 2 min; 5 cycles at 95°C for 45 s, 53°C for 1 min, and 72°C for min; and 35 cycles at 95°C for 30 s, 51°C for 30 s, and 72°C for 45 s. Positive pools of fecal samples from Edinburgh were divided and individual component samples were tested.

Respiratory and fecal samples from both centers were screened by using universal primers, and positive samples were digested with RsaI. Undigested amplicons and some predicted HBoV-1 fragments (46 bp and 91 bp) were sequenced to confirm virus identity. All samples were additionally screened with HBoV-2–specific primers; 16 undigested samples were positive with HBoV-2–specific primers, and all samples identified as HBoV-1 were negative. Thus, species-specific primers enabled effective screening of HBoV-2 among samples with high frequencies of HBoV-1.

Figure

Figure. Age distribution of study participants with positive fecal (A) and respiratory (B) sample results for human bocavirus (HBoV), subdivided by HBoV species...

HBoV-positive fecal samples were generally restricted to children <5 years of age (25 from 30 infected children whose ages were known) (Figure, panel A; Table). Median age of children infected with HBoV-2 (7–12 months) was lower than that for those infected with HBoV-1 (1–2 years). Infections with HBoV-1 and HBoV-2 were observed at low frequencies in older persons (2 and 5 of 1,791 persons >35 years of age, respectively). For respiratory samples, HBoV-1 infections showed a similar peak incidence among children 1–2 years of age (Figure, panel B), similar to that observed for fecal samples. This age group was most frequently infected in our previous analyses of respiratory samples from Edinburgh (12). There were no differences in frequencies of HBoV-1 or HBoV-2 infection between male and female participants. Samples from Bangkok were divided into those from persons with diarrhea (327) and asymptomatic controls (213); detection of HBoV-1 and HBoV-2 was restricted to persons with diarrhea (n = 12 and 2, respectively).

In contrast to its frequent detection in fecal samples, HBoV-2 was not detected in >6,500 respiratory samples (Table). However, high frequencies of HBoV-1 were recorded (14% among children in Bangkok and 3.4% among children in Edinburgh); the group from Edinburgh contained a substantial number of older children (37% >5 years of age).

Conclusions
Four conclusions can be drawn from this study. First, HBoV-2 circulates in 3 widely separated areas (United Kingdom, Thailand, and Pakistan [11]) and is likely distributed globally. Second, infections with HBoV-2 show a pattern of infecting young children, most <1 year of age. Third, absence of HBoV-2 in respiratory samples suggests a different tissue tropism that may influence its transmission route and ability to infect systemically and establish persistence. Determining the biologic basis for such differences will be useful in understanding the pathogenesis of HBoV-1–related respiratory disease. Fourth, at a practical level, absence of HBoV-2 in respiratory samples indicates no likely role for this virus in respiratory disease. Thus, screening methods may be adequate for detecting HBoV-associated respiratory disease. Nevertheless, the unexpectedly diverse human bocavirus group may contain additional variants with potential etiologic roles in respiratory or other diseases.

Since this study was completed, evidence for an interspecies HBoV-1/-2 recombinant associated with acute gastroenteritis has been obtained; the structural gene region was most closely related to HBoV-2, and NS1/NP-1 grouping with HBoV-1 (14). Although this recombinant would have been identified as HBoV-1 by using typing assays described in the current study, sequence analysis of HBoV-1–positive samples in this study and our previous study of respiratory samples from Edinburgh and Bangkok (12,15) identified only HBoV-1 in the study population, consistent with all other analyses of this sample type worldwide. Nevertheless, future typing assays should analyze both VP1/2 and NS/NP-1 to ensure that this and potentially other interspecies recombinants are identified. Investigation of genetic diversity of this group and development of effective screening methods for variants of HBoV is required for studies of human disease.

Acknowledgments
We thank Gillian Fewster and the staff at the Microbiology Laboratory, Western General Hospital, Edinburgh, for providing fecal surveillance samples; and Elly Gaunt, Kate Templeton, and Carol Thomson for providing samples, data, and other virus testing results from the respiratory sample archive.

T.C. was supported by the Royal Golden Jubilee PhD Program; the Thailand Research Fund; the Center of Excellence in Clinical Virology, Chulalongkorn University; Biomedical Science, Graduate School, Chulalongkorn University; and the Commission on Higher Education, Ministry of Education, Thailand.

Mr Chieochansin is a doctoral candidate at the Center of Excellence in Clinical Virology, Chulalongkorn University, Bangkok, Thailand. His research interests include evolution and epidemiology of virus infections and interactions with their hosts.

References
Allander T, Tammi MT, Eriksson M, Bjerkner A, Tiveljung-Lindell A, Andersson B. Cloning of a human parvovirus by molecular screening of respiratory tract samples. Proc Natl Acad Sci U S A. 2005;102:12891–6. PubMed DOI
Schildgen O, Muller A, Allander T, Mackay IM, Volz S, Kupfer B, et al. Human bocavirus: passenger or pathogen in acute respiratory tract infections? Clin Microbiol Rev. 2008;21:291–304. PubMed DOI
Vicente D, Cilla G, Montes M, Perez-Yarza EG, Perez-Trallero E. Human bocavirus, a respiratory and enteric virus. Emerg Infect Dis. 2007;13:636–7.
Neske F, Blessing K, Tollmann F, Schubert J, Rethwilm A, Kreth HW, et al. Real-time PCR for diagnosis of human bocavirus infections and phylogenetic analysis. J Clin Microbiol. 2007;45:2116–22. PubMed DOI
Cheng WX, Jin Y, Duan ZJ, Xu ZQ, Qi HM, Zhang Q, et al. Human bocavirus in children hospitalized for acute gastroenteritis: a case-control study. Clin Infect Dis. 2008;47:161–7. PubMed DOI
Chieochansin T, Thongmee C, Vimolket L, Theamboonlers A, Poovorawan Y. Human bocavirus infection in children with acute gastroenteritis and healthy controls. Jpn J Infect Dis. 2008;61:479–81.
Schildgen O, Muller A, Simon A. Human bocavirus and gastroenteritis. Emerg Infect Dis. 2007;13:1620–1.
Carmichael LE, Schlafer DH, Hashimoto A. Minute virus of canines (MVC, canine parvovirus type-1): pathogenicity for pups and seroprevalence estimate. J Vet Diagn Invest. 1994;6:165–74.
Durham PJ, Lax A, Johnson RH. Pathological and virological studies of experimental parvoviral enteritis in calves. Res Vet Sci. 1985;38:209–19.
Kesebir D, Vazquez M, Weibel C, Shapiro ED, Ferguson D, Landry ML, et al. Human bocavirus infection in young children in the United States: molecular epidemiological profile and clinical characteristics of a newly emerging respiratory virus. J Infect Dis. 2006;194:1276–82. PubMed DOI
Kapoor A, Slikas E, Simmonds P, Chieochansin T, Naeem A, Shaukat S, et al. A newly identified bocavirus species in human stool. J Infect Dis. 2009;199:196–200. PubMed DOI
Manning A, Russell V, Eastick KL, Hallam N, Templeton KE, Simmonds P. Epidemiological profile and clinical associations of human bocavirus and other human parvoviruses. J Infect Dis. 2006;194:1283–90. PubMed DOI
Harvala H, Robertson I, McWilliam Leitch EC, Benschop K, Wolthers KC, Templeton K, et al. Epidemiology and clinical associations of human parechovirus respiratory infections. J Clin Microbiol. 2008;46:3446–53. PubMed DOI
Arthur JL, Higgins GD, Davidson GP, Givney RC, Ratcliff RM. A novel bocavirus associated with acute gastroenteritis in Australian children. PLoS Pathog. 2009;5:e1000391. PubMed DOI
Chieochansin T, Samransamruajkit R, Chutinimitkul S, Payungporn S, Hiranras T, Theamboonlers A, et al. Human bocavirus (HBoV) in Thailand: clinical manifestations in a hospitalized pediatric patient and molecular virus characterization. J Infect. 2008;56:137–42. PubMed DOI
Figure
Figure. Age distribution of study participants with positive fecal (A) and respiratory (B) sample results for human bocavirus (HBoV), subdivided by HBoV species...

Table (please, see the full-text)
Table. Frequency of human bocavirus species 1 and 2 in respiratory and fecal samples, United Kingdom and Thailand

Suggested Citation for this Article
Chieochansin T, Kapoor A, Delwart E, Poovorawan Y, Simmonds P. Absence of detectable replication of human bocavirus species 2 in respiratory tract. Emerg Infect Dis [serial on the Internet]. 2009 Sep 2009 [date cited]. Available from http://www.cdc.gov/EID/content/15/9/1503.htm

DOI: 10.3201/eid1509.090394

abrir aquí para acceder al documento CDC completo:
Replication of HBoV-2 in Respiratory Tract | CDC EID

Surveillance for Hepatitis C Virus, USA | CDC EID

Volume 15, Number 9–September 2009
Dispatch
Population-based Surveillance for Hepatitis C Virus, United States, 2006–2007
R. Monina Klevens, Jeremy Miller, Candace Vonderwahl, Suzanne Speers, Karen Alelis, Kristin Sweet, Elena Rocchio, Tasha Poissant, Tara M. Vogt, and Kathleen Gallagher
Author affiliations: Centers for Disease Control and Prevention, Atlanta, Georgia, USA (R.M. Klevens, J. Miller, T.M. Vogt, K. Gallagher); Colorado Department of Health, Denver, Colorado, USA (C. Vonderwahl); Connecticut Department of Public Health, Hartford, Connecticut, USA (S. Speers); Florida Health Department of Pinellas County, St. Petersburg, Florida, USA (K. Alelis); Minnesota Department of Health, St. Paul, Minnesota, USA (K. Sweet); New York State Department of Health, Albany, New York, USA (E. Rocchio); and Oregon Public Health Division, Portland, Oregon, USA (T. Poissant)

Suggested citation for this article

Abstract
Surveillance for hepatitis C virus infection in 6 US sites identified 20,285 newly reported cases in 12 months (report rate 69 cases/100,000 population, range 25–108/100,000). Staff reviewed 4 laboratory reports per new case. Local surveillance data can document the effects of disease, support linkage to care, and help prevent secondary transmission.

Hepatitis C virus (HCV) infection is a serious public health problem in the United States and throughout the world. At least 80% of acute infections become chronic (1); an estimated 3.2 million persons in the United States alone have chronic HCV infection (2). In 2004, an HCV diagnosis was made in 936 of 100,000 outpatient visits for healthcare and in 143 of 100,000 hospital discharges (3). This is a chronic infection in which complications are manifested decades after the initial infection. Complications and costs associated with chronic HCV infection are anticipated to increase during 2010–2019 (4), because the incidence of new infections peaked from the late 1960s to early 1980s (5).

Although identifying persons with HCV infection, including asymptomatic persons, is challenging, the benefits for overall public health make it worthwhile. Infected persons can be referred to care (6), treated (if appropriate) (7), and counseled to prevent complications. The Centers for Disease Control and Prevention (CDC) and the Council of State and Territorial Epidemiologists recognized these benefits, and in 2003, recommended that past or present infections with HCV (hereafter referred to as HCV infection because most of these cases likely represent chronic rather than acute or resolved HCV infections) become a nationally reportable condition. Surveillance for acute non-A, non-B hepatitis, which was mostly HCV infection, has been performed in the United States since 1982, but in 2007, a total of 33 states also conducted surveillance for HCV infection and reported 133,520 cases to CDC; however, these data remain unpublished.

The Study
Our study had 2 objectives. The first objective was to describe findings from 6 US state or county health departments that have been funded by CDC to perform enhanced surveillance for HCV infection. The second objective was to discuss the limitations and challenges of conducting population-based surveillance for HCV infection in the United States.

The sites where enhanced hepatitis surveillance was conducted during 2006–2007 were Colorado, Connecticut, Minnesota, New York (excluding New York City), and Oregon; Pinellas County, Florida, a sentinel counties (8) site, also contributed hepatitis C reports. The combined population under surveillance from the 5 states and 1 county was an estimated 29.3 million in 2007 (Table). In each of these jurisdictions, clinical laboratories are required to report positive results from HCV assays. For this analysis, a confirmed case of HCV infection was identified in any person who, from July 1, 2006 through June 30, 2007, had at least 1 of the following: 1) a positive result for an HCV recombinant immunoblot assay (RIBA), 2) a positive nucleic acid test (NAT) result for HCV RNA, 3) a documented HCV genotype, or 4) a positive result for a screening test for antibodies against HCV (anti-HCV) with a signal-to-cutoff (s:co) ratio predictive of a true positive result for the given assay.

Laboratories and providers continuously reported positive results for HCV markers (e.g., anti-HCV, RIBA, NAT, genotype) to state or local health departments. Health department staff checked patients' names and dates of birth from each report against a surveillance database to determine whether a case had been previously reported. Newly reported cases (i.e., previously not captured in the database of this jurisdiction) were entered into this database along with hepatitis test results. Health department staff investigated cases and collected basic demographic and clinical information to confirm the case definition and to epidemiologically describe the case. We calculated rates of newly reported cases by using denominators available from the 2007 population estimates from the US Bureau of the Census (www.census.gov/compendia/statab).

Two supplemental assessments were conducted. The first assessment measured the number of laboratory reports associated with each new case. Staff at each site monitored a convenience sample of laboratory reports and measured the number excluded, reasons for exclusion, and the number that eventually were classified as newly reported cases. The second assessment determined the validity of basic epidemiologic information. For this task, CDC drew a random sample of 10 cases per site from among those reported during the 12-month reporting period (n = 60) and extracted the following variables: date of birth, county of residence, sex, race, and clinical test results associated with HCV infection. Surveillance staff contacted at least 1 healthcare provider to independently collect this information. We measured agreement between the information initially reported and the information collected during the validation using a κ statistic (9).

The 6 sites reported a total of 20,285 cases of confirmed HCV infection that were previously unreported in their respective jurisdictions (Table). Of these, 66% of case-patients were male and 56% were 40–54 years of age (men and women combined) (Table). More than half (52%) of the reports lacked information on race or ethnicity. Most cases (89%) were reported by clinical laboratories. The laboratory criterion most frequently reported was a positive result for HCV RNA (53%). The rate of new reports of past or present HCV infection was 69/100,000 population (range 25–108/100,000).

Sites monitored all incoming reports on average for 8 days (range 5–16 days). A total of 2,180 reports were received and, among these, 491 (23%, range 13%–52%) met the case definition and were considered newly reported cases; Oregon had the highest proportion of newly reported cases (52%) and the newest registry. The remaining reports fell into the following categories: already in the database (68%, range 30%–78%), lacking value for s:co ratio (5%, range 3%–13%), negative test results for an HCV marker (2%, range 1%–4%), or missing key demographic data (1%, range 0%–2%).

All cases were confirmed to meet the case definition. Agreement was high for age (κ = 1.0, p<0.001), sex (κ = 0.96; p<0.001), and county of residence (κ = 1.0; p<0.001); county data were missing for 6 (10%) cases.

Conclusions
We documented that for every 4 laboratory reports, ≈1 newly reported case of HCV infection was identified. The overall annual rate of new case reports was 69/100,000 population in 6 sites that were conducting enhanced surveillance. In the 4 states (Colorado, Connecticut, Minnesota, Oregon) for which comparable data were available, the number of newly reported cases of HCV infection was at least 4× the number of newly reported HIV infections in 2006 (10). The 1 county in Florida was not included in the comparison because no HIV data were available.

Two limitations must be mentioned. First, we do not know how many of the newly reported cases represent current infections. In the United States, 80% of prevalent anti-HCV–positive cases are HCV RNA positive (2); thus, most laboratory confirmed cases reported to surveillance are likely chronic infections, but could also represent acute or resolved infections. Electronic laboratory reporting is the most efficient way to identify potential cases (11), but because no current laboratory test can distinguish acute from chronic HCV infections, identification of acute-phase cases requires contacting the provider or patient to determine whether acute symptoms were present. Due to the high volume of reports received, this level of follow-up was not routinely conducted.

The second major limitation is that testing patterns in the community are unknown. Providers are inconsistent about eliciting risk factor information and about testing and referring patients to specialists (12). Patient access to care and structural factors in institutions (e.g., incentives and disincentives for testing at jails, prisons, and drug treatment programs) and in the community (e.g., screenings) also affect testing and, therefore, the reporting rate.

The greatest value of conducting surveillance for chronic HCV at the state and local level is to measure local frequency of disease. Local and state health departments share information such that changes of residence of cases within the state over time would not result in a duplicate case count. However, in aggregating these data at the national level, an infected person who moved from 1 state to another would likely trigger a new report in another state, thus resulting in an overestimate of the national prevalence. Therefore, as a coordinated surveillance system for chronic HCV is developed, a mechanism to prevent duplication of cases across states will need to be developed.

Many factors affect case reporting, such as, local public health reporting requirements, the sophistication and capacity of laboratories to electronically report de-duplicated positive test results, availability of health department staff to conduct investigations and follow-up on reports, time since registry was initiated, and the capacity of the system to maintain ongoing surveillance efforts. Without an understanding of these factors, interpreting the meaning of new HCV infection case reports is difficult.

Local health departments need chronic HCV infection surveillance to document effects of disease, identify persons in need of linkage to care, and prevent complications among persons infected (13). However, accurately collecting the necessary information is challenging for health departments, and we currently lack evidence that obtaining these data will result in a lower incidence of illness and death. A full assessment of the benefits and costs of conducting comprehensive surveillance for chronic HCV infection is overdue. Currently, the enhanced hepatitis surveillance sites are developing recommendations for best practices and plan to share methods and tools with all interested health departments. Future studies should evaluate what level of surveillance for chronic HCV is feasible and whether the prevention benefit is worth the effort.

Acknowledgments
We thank T. Bryant, K. Gerard, A Gamarra, A Sofair, S. Huie-White, N. Stabach, B. Lovely, C. Noonan-Toly, A. Fountain, G. Van Ness, A. Thomas, D. Daniels, and E. Din for their contributions to this study.

Dr Klevens is a medical epidemiologist in the Division of Viral Hepatitis at CDC. She is the CDC principal investigator for hepatitis surveillance in the Emerging Infections Program. She also provides epidemiologic support for hepatitis surveillance in the National Notifiable Diseases Surveillance System.

References
Alter MJ, Margolis HS, Krawczynski K, Judson FN, Mares A, Alexander WJ, et al. The natural history of community-acquired hepatitis C in the United States. The Sentinel Counties Chronic Non-A, Non-B Hepatitis Study Team. N Engl J Med. 1992;327:1899–905.
Armstrong GL, Wasley A, Simard EP, McQuillan GM, Kuhnert WL, Alter MJ. The prevalence of hepatitis C virus infection in the United States, 1999 through 2002. Ann Intern Med. 2006;144:705–14.
Everhart JE. Viral hepatitis. In: Everhart JE, editor. The burden of digestive diseases in the United States. Washington: National Institute of Diabetes and Digestive and Kidney Diseases. Washington: Government Printing Office; 2008. NIH publication no. 09-6443. p. 13–23.
Wong JB, McQuillan GM, McHutchison JG, Poynard T. Estimating future hepatitis C morbidity, mortality, and costs in the United States. Am J Public Health. 2000;90:1562–9. PubMed DOI
Armstrong GL, Alter MJ, McQuillan GM, Margolis HS. The past incidence of hepatitis C virus infection: implications for the future burden of chronic liver disease in the United States. Hepatology. 2000;31:777–82. PubMed DOI
Yawn BP, Gazzuola L, Wollan PC, Kim WR. Development and maintenance of a community-based hepatitis C registry. Am J Manag Care. 2002;8:253–61.
Strader DB, Wright T, Thomas DL, Seef LB. Diagnosis, management, and treatment of hepatitis C. Hepatology. 2004;39:1147–71. PubMed DOI
Bell BP, Shapiro C, Alter MJ, Moyer LA, Judson FN, Mottram K, et al. The diverse patterns of hepatitis A epidemiology in the United States: implications for vaccination strategies. J Infect Dis. 1998;178:1579–84. PubMed DOI
Fleiss J. The measurement of interrater agreement. In: Statistical methods for rates and proportions, 2nd ed. New York: Wiley Interscience; 1981. p. 212–36.
Centers for Disease Control and Prevention. HIV/AIDS surveillance report 2007;18 [cited 2009 Jan 14]. Available from http://www.cdc.gov/hiv/topics/surveillance/resources/reports/2006report/default.htm
Centers for Disease Control and Prevention. Automated detection and reporting of notifiable diseases using electronic medical records versus passive surveillance—Massachusetts, June 2006–July 2007. MMWR Morb Mortal Wkly Rep. 2008;57:373–6.
Shehab TM, Sonnad SS, Lok AS. Management of hepatitis C patients by primary care physicians in the USA: results of a national survey. J Viral Hepat. 2001;8:377–83. PubMed DOI
Centers for Disease Control and Prevention. Recommendations for prevention and control of hepatitis C virus (HCV) infection and HCV-related chronic disease. MMWR Recomm Rep. 1998;47(RR-19):1–39.
Table (please, see the full-text)
Table. Newly reported cases of past or present HCV infection in 6 US locations, July 1, 2006–June 30, 2007

Suggested Citation for this Article
Klevens RM, Miller J, Vonderwahl C, Speers S, Alelis K, Sweet K, et al. Population-based surveillance for hepatitis C virus, United States, 2006–2007. Emerg Infect Dis [serial on the Internet]. 2009 Sep [date cited]. Available from http://www.cdc.gov/EID/content/15/9/1499.htm

DOI: 10.3201/eid1509.081050

abrir aquí para acceder al documento CDC completo:
Surveillance for Hepatitis C Virus, USA | CDC EID

Merkel Cell Polyomavirus | CDC EID

Volume 15, Number 9–September 2009
Dispatch
Merkel Cell Polyomavirus DNA in Persons without Merkel Cell Carcinoma
Ulrike Wieland, Cornelia Mauch, Alexander Kreuter, Thomas Krieg, and Herbert Pfister
Author affiliations: Institute of Virology, Koeln, Germany (U. Wieland, H. Pfister); Department of Dermatology, Koeln (C. Mauch, T. Krieg); and Department of Dermatology, Bochum, Germany (A. Kreuter)

Suggested citation for this article

Abstract
Merkel cell polyomavirus (MCPyV) DNA was detected in 88% of Merkel cell carcinomas in contrast to 16% of other skin tumors. MCPyV was also found in anogenital and oral samples (31%) and eyebrow hairs (50%) of HIV-positive men and in forehead swabs (62%) of healthy controls. MCPyV thus appears to be widespread.

Merkel cell polyomavirus (MCPyV) was recently discovered in Merkel cell carcinomas (MCC), rare but aggressive skin cancers (1). MCPyV DNA has been detected in the majority of MCC and less commonly in other skin tumors and healthy skin (1–6). To help determine if MCPyV might be widespread in the general population, we conducted a retrospective study and tested MCC as well as healthy and lesional skin and mucosa samples of immunocompetent and immunosuppressed persons without MCC for MCPyV-DNA.

The Study
All samples (n = 355) were analyzed by hot-start single-round LT3-PCR (sPCR) and nested LT1/M1M2-PCR (nPCR) by using primers described previously (1) (experimental details on DNA isolation, controls, and PCR conditions are available from U.W.). Because analytical sensitivities of sPCR and nPCR were 1,000 copies of cloned LT3-DNA and 10 copies of cloned LT1-DNA per assay, samples positive by both PCRs probably had higher viral loads than those positive only by nPCR. The sPCR- or nPCR-products of 19 MCC and 48 non-MCC samples were sequenced and were MCPyV specific.

MCPyV DNA was detectable in 30/34 (88%) MCC biopsies and in 5/5 (100%) MCC metastases by nPCR, and in 68% and 80%, respectively, by sPCR. MCPyV DNA was found by nPCR only in 1/13 (7.7%) whole blood samples of MCC-patients. The patient with MCPyV-positive blood had positive sPCR/nPCR results for MCC and positive nPCR results for a second sample taken from the previous MCC site. Of 5 further non-MCC biopsy samples from MCC patients, 1 skin sample from a patient with unspecific dermatitis was positive by nPCR.

MCPyV DNA was traceable only by nPCR in 10/61 (16%) biopsy samples of different non-MCC skin tumors and in 8/34 (24%) of perilesional, clinically, and histologically healthy skin samples from 56 immunocompetent patients (7) without MCC (Table 1). MCPyV DNA status was identical in 30/32 pairs of tumor and corresponding perilesional skin samples (negative/negative in 24, positive/positive in 6, divergent in 2 pairs). MCPyV was found significantly more often in MCC (n = 34) than in non-MCC skin tumors (n = 61) or perilesional skin biopsies (n = 34) (p<0.001; χ2 test).

Mucosal samples were available from 79 HIV-infected men who have sex with men (HIV-MSM) (without MCC) participating in an anogenital dysplasia/human papillomavirus (HPV) screening program (8). MCPyV DNA was detectable in 37/120 (31%) of all mucosal (anal, penile, oral) samples by nPCR and in 10/120 (8%) by sPCR (Table 2). In anal samples, MCPyV DNA positivity was lowest in anal cancer tissues (14% by nPCR), followed by dysplasias (26%), swabs with normal cytology (30%), and benign lesions (33%). Similar values were found for penile samples; 29% of dysplasias, 33% of benign lesions, and 50% of normal swabs were MCPyV DNA positive. In oral samples, MCPyV DNA was detected in 39% of normal swabs, in 0% of benign lesions, and in 50% of carcinomas in situ. MCPyV DNA positivity was not associated with the presence of mucosal premalignant and malignant lesions (p = 0.597; n = 120; 1-sided analysis of variance test), in contrast to positivity for high-risk (HR)-alpha-HPV, the established etiologic agents of these lesions (p = 0.001; n = 120) (Table 2). MCPyV DNA positivity was not significantly different in mucosal samples from HIV-MSM with CD4 counts below or above 200/μL (29% vs. 32%; p = 0.839; n = 120; χ2 test). For HR-HPV, a trend for a higher detection rate in patients with CD4 counts <200/μL could be observed (80% vs. 67%; p = 0.145; n = 120) (Table 2). In 7 cerebrospinal fluid samples from HIV-MSM with central nervous system problems, MCPyV DNA was not detected.

In an immunodeficient patient with WILD syndrome (warts, immunodeficiency, lymphedema, anogenital dysplasia) (9), MCPyV DNA was found by nPCR and sPCR on the abdominal, thigh, perianal, and vulvar skin, and by nPCR in the vagina, cervix, and intraanal canal (20/27 swabs were nPCR- and 4/27 sPCR-positive). A whole blood sample and 5 papilloma biopsies were MCPyV DNA negative. MCPyV DNA was detected by nPCR in the cellular pellet but not in the supernatant of a urine sample of the patient with WILD syndrome. The presence of MCPyV DNA in the cellular pellet was probably caused by MCPyV- positive urogenital cells flushed into the urine.

MCPyV DNA was not found in 13 BKPyV DNA positive urine samples from 11 renal-transplant recipients without MCC. MCPyV DNA was detected by nPCR in 7/14 (50%) of plucked eyebrow hairs of 14 HIV-MSM and by sPCR in 5/14 (36%) (Table 2) as well as in eyebrow hairs of the patient with WILD syndrome (nPCR-positive). Skin swabs covering 20 cm2 of the forehead were taken from 13 healthy immunocompetent male adults (10), and MCPyV DNA was detected by nPCR in 8/13 (62%) and by sPCR in 5/13 (38%).

Conclusions
Using nested PCR, we found MCPyV DNA in 88% of in samples from persons with MCC. In 68%, viral DNA load was high enough to be detectable by sPCR. This finding is similar to detection rates reported before (54%–89%) (1–6) and confirms the association of MCPyV with MCC.

The MCPyV positivity of 16% in non-MCC skin tumors was significantly lower than in MCC; MCPyV DNA was only detectable by nPCR, pointing to lower viral loads than in MCC. Similar to our results, MCPyV DNA has been found in 12.5% of basal cell carcinomas and viral load was 4-log lower than in MCC (2). In other studies, MCPyV DNA was detected in 13% of squamous cell carcinomas and only in 1 keratoacanthoma of 156 non-melanoma skin cancers (4,6). The relatively low detection rate of MCPyV in non-MCC skin tumors, similar to that in healthy, perilesional skin, suggests that MCPyV probably does not play a role in the development of non-MCC skin tumors.

HR-alpha-HPV induces anogenital dysplasia/cancer and HIV-MSM have a strongly increased risk for developing these lesions (11). In anogenital samples of HIV-MSM, MCPyV DNA was less common in premalignant and malignant lesion samples than in benign samples or samples with normal cytology. Thus, it is unlikely that MCPyV plays a role in the development of anogenital dysplasia/cancer in HIV-MSM. In contrast to HR-alpha-HPV, MCPyV recovery was not increased in HIV-MSM with advanced immunodeficiency.

MCPyV DNA was detected only once in hematolymphoid tissue and never in donated blood (5,12). Similarly, we could not detect MCPyV DNA in 12/13 blood samples obtained from patients with MCC and in the blood sample of the patient with WILD syndrome, who was MCPyV positive in numerous other samples. MCPyV DNA was not found in BKPyV-positive urine samples from renal transplant recipients or in the cell-free urine supernatant of the patient with WILD syndrome.

In normal skin, MCPyV DNA has been identified before by PCR and Southern blot in 1/6 biopsies (1) but not in 15 samples when real-time PCR was used (4). Surprisingly, we found MCPyV DNA by sPCR in 38% and by nPCR in 62% of area-wide skin swabs from the forehead of healthy controls. Furthermore, MCPyV DNA was found in 14% and 37% of normal mucosa swabs of HIV-MSM by sPCR and nPCR, respectively. Since Merkel cells are found within the basal layer of the epidermis (13), it is unlikely that they are collected in surface-swabs. This observation suggests that the detected MCPyV DNA either represents cell-free virus that may have been produced in Merkel cells or virus in superficial keratinocytes. Thirty-six percent (sPCR) and 50% (nPCR) of eyebrow hairs of HIV-MSM carried MCPyV DNA. High concentrations of Merkel cells were described in the bulge region of hair follicles (14). Hair bulbs have been suggested as a reservoir for beta-HPVs (15), and this may also be true for MCPyV. Our data demonstrate a widespread distribution of MCPyV in normal skin, mucosa and hair bulbs, although MCPyV does not reach the magnitude found for ubiquitous beta-HPV (10,15). Our nonpopulation based data need to be confirmed in cross-sectional studies, but it is likely that MCPyV is prevalent in the general population.

Acknowledgments
We thank Monika Junk and Nabila Ristow for excellent technical assistance, Soenke Weissenborn for support in statistical analyses, and Martin Hufbauer for assistance in cloning of PCR products.

This work was supported by the German Federal Ministry of Education and Research grant no. 01 KI 0771 (TP7) and by the Center for Molecular Medicine of the University of Cologne.

Dr Wieland is a professor of virology at the Institute of Virology of the University of Cologne. She specializes in medical microbiology and virology. Her research interests include diagnosis and therapy of papillomavirus-induced diseases.

References
Feng H, Shuda M, Chang Y, Moore PS. Clonal integration of a polyomavirus in human Merkel cell carcinoma. Science. 2008;319:1096–100. PubMed DOI
Becker JC, Houben R, Ugurel S, Trefzer U, Pfohler C, Schrama D. MC polyomavirus Is frequently present in Merkel cell carcinoma of European patients. J Invest Dermatol. 2009;129:248–50. PubMed DOI
Foulongne V, Kluger N, Dereure O, Brieu N, Guillot B, Segondy M. Merkel cell polyomavirus and Merkel cell carcinoma, France. Emerg Infect Dis. 2008;14:1491–3. PubMed DOI
Garneski KM, Warcola AH, Feng Q, Kiviat NB, Leonard JH, Nghiem P. Merkel cell polyomavirus is more frequently present in North American than Australian Merkel cell carcinoma tumors. J Invest Dermatol. 2009;129:246–8. PubMed DOI
Kassem A, Schopflin A, Diaz C, Weyers W, Stickeler E, Werner M, et al. Frequent detection of Merkel cell polyomavirus in human Merkel cell carcinomas and identification of a unique deletion in the VP1 gene. Cancer Res. 2008;68:5009–13. PubMed DOI
Ridd K, Yu S, Bastian BC. The presence of polyomavirus in non-melanoma skin cancer in organ transplant recipients is rare. J Invest Dermatol. 2009;129:250–2. PubMed DOI
Weissenborn SJ, Nindl I, Purdie K, Harwood C, Proby C, Breuer J, et al. Human papillomavirus-DNA loads in actinic keratoses exceed those in non-melanoma skin cancers. J Invest Dermatol. 2005;125:93–7. PubMed DOI
Kreuter A, Brockmeyer NH, Weissenborn SJ, Gambichler T, Stucker M, Altmeyer P, et al. Penile intraepithelial neoplasia is frequent in HIV-positive men with anal dysplasia. J Invest Dermatol. 2008;128:2316–24. PubMed DOI
Kreuter A, Hochdorfer B, Brockmeyer NH, Altmeyer P, Pfister H, Wieland U. A human papillomavirus-associated disease with disseminated warts, depressed cell-mediated immunity, primary lymphedema, and anogenital dysplasia: WILD syndrome. Arch Dermatol. 2008;144:366–72. PubMed DOI
Weissenborn SJ, De Koning MN, Wieland U, Quint WG, Pfister HJ. Intrafamilial transmission and family-specific spectra of cutaneous beta-papillomaviruses. J Virol. 2009;83:811–6. PubMed DOI
Palefsky J. Human papillomavirus-related tumors in HIV. Curr Opin Oncol. 2006;18:463–8. PubMed DOI
Sharp CP, Norja P, Anthony I, Bell JE, Simmonds P. Reactivation and mutation of newly discovered WU, KI, and Merkel cell carcinoma polyomaviruses in immunosuppressed individuals. J Infect Dis. 2009;199:398–404. PubMed DOI
Moll I, Moll R. Early development of human Merkel cells. Exp Dermatol. 1992;1:180–4. PubMed DOI
Narisawa Y, Hashimoto K, Nakamura Y, Kohda H. A high concentration of Merkel cells in the bulge prior to the attachment of the arrector pili muscle and the formation of the perifollicular nerve plexus in human fetal skin. Arch Dermatol Res. 1993;285:261–8. PubMed DOI
Boxman IL, Berkhout RJ, Mulder LH, Wolkers MC, Bouwes Bavinck JN, Vermeer BJ, et al. Detection of human papillomavirus DNA in plucked hairs from renal transplant recipients and healthy volunteers. J Invest Dermatol. 1997;108:712–5. PubMed DOI
Table (please, see the full-text)
Table 1. MCPyV DNA in biopsies of immunocompetent patients without MCC
Table 2. MCPyV DNA and human papillomavirus DNA in samples of HIV-positive men without Merkel cell carcinoma

Suggested Citation for this Article
Wieland U, Mauch C, Kreuter A, Krieg T, Pfister H. Merkel cell polyomavirus DNA in persons without Merkel cell carcinoma. Emerg Infect Dis [serial on the Internet] 2009 Sep [date cited]. Available from http://www.cdc.gov/EID/content/15/9/1496.htm

DOI: 10.3201/eid1509.081575

abrir aquí para acceder al documento CDC completo:
Merkel Cell Polyomavirus | CDC EID

HPAI Virus A (H7N3) in Saskatchewan, Canada, 2007 | CDC EID

Volume 15, Number 9–September 2009
Dispatch
Highly Pathogenic Avian Influenza Virus A (H7N3) in Domestic Poultry, Saskatchewan, Canada, 2007
Yohannes Berhane, Tamiko Hisanaga, Helen Kehler, James Neufeld, Lisa Manning, Connie Argue, Katherine Handel, Kathleen Hooper-McGrevy, Marilyn Jonas, John Robinson, Robert G. Webster, and John Pasick
Author affiliations: Canadian Food Inspection Agency, Winnipeg, Manitoba, Canada (Y. Berhane, T. Hisanaga, H. Kehler, J. Neufeld, L. Manning, C. Argue, K. Handel, K. Hooper-McGrevy, J. Pasick); Prairie Diagnostic Services, Saskatoon, Saskatchewan, Canada (M. Jonas); British Columbia Ministry of Agriculture and Lands, Abbotsford, British Columbia, Canada (J. Robinson); and St. Jude Children's Research Hospital, Memphis, Tennessee, USA (R.G. Webster)

Suggested citation for this article

Abstract
Epidemiologic, serologic, and molecular phylogenetic methods were used to investigate an outbreak of highly pathogenic avian influenza on a broiler breeding farm in Saskatchewan, Canada. Results, coupled with data from influenza A virus surveillance of migratory waterfowl in Canada, implicated wild birds as the most probable source of the low pathogenicity precursor virus.

Wild aquatic birds of the orders Anseriformes and Charadriiformes are the natural reservoir for influenza A viruses (1) and are thought to serve as a source of virus that leads to outbreaks in domestic poultry. However, direct evidence for this suggestion is often difficult to demonstrate.

On September 22, 2007, a broiler hatching egg operation near Regina Beach, Saskatchewan, Canada, experienced a sudden increase in deaths (140 [36%] of 390 birds) in a barn that housed 24-week-old roosters. The premises contained 53,000 birds of multiple ages housed in 10 confinement barns. On September 23, deaths in the rooster barn increased to 240 (62%). Postmortem examination findings, which showed lesions compatible with highly pathogenic avian influenza (HPAI), resulted in a Canadian Food Inspection Agency team being dispatched to the premises. The farm was placed under quarantine, and specimens were submitted to the regional Avian Influenza Network laboratory in Saskatoon, Saskatchewan, and the National Centre for Foreign Animal Disease in Winnipeg, Manitoba, for diagnosis. A complete account of the index premises, disease control actions, and description of the Saskatchewan poultry industry is online at www.inspection.gc.ca/english/anima/heasan/disemala/avflu/2007sask/repsaske.shtml.

The Study
Six pools (5 samples per pool) of cloacal swab specimens, 6 pools (5 samples per pool) of oropharyngeal swab specimens, 6 pools of 10% (wt/vol) tissue (heart, liver, lung, and spleen), 6 pools of intestine homogenates, and 2 pools of brain homogenates were tested by using real-time reverse transcription–PCR (RT-PCR) assays specific for the influenza A virus matrix gene (2), H5 and H7 hemagglutinin (HA) subtype genes (2), and avian paramyxovirus serotype-1 matrix gene (3). Virus isolation was performed by using embryonating chicken eggs according to international standards (4). RT-PCR of swab and tissue samples showed positive results for influenza A matrix but negative results for H5 and H7 subtypes and avian paramyxovirus serotype-1.

Because of apparent inconsistencies between these initial results and clinical signs observed on the farm, further analyses were conducted by using conventional RT-PCR assays with universal primers designed to amplify the complete HA gene and the 9 neuraminidase gene subtypes of avian influenza virus (5). Results from these ancillary tests showed evidence for an avian influenza virus (H7N3), which was subsequently confirmed by virus isolation and subtyping by hemagglutination-inhibition and neuraminidase-inhibition assays (4).

Viral isolates grew well in the chicken host, producing HA titers as high as 1,024. The derived amino acid sequence of the HA0 cleavage site, PENPKTTKPRPRR/GLF, (underlined amino acids indicate a 6-aa insert) conformed to the definition of the World Organisation for Animal Health for HPAI virus (4). Intravenous inoculation of 4- to 6-week-old chickens (4) with isolate A/chicken/Saskatchewan/HR-00011/2007 resulted in all birds dying within 24 hours, giving an intravenous pathogenicity index of 3.0. This finding confirmed the molecular pathotype. Tissues from dead roosters showed specific influenza A virus immunolabeling in all organs examined, including the central nervous system, a characteristic of HPAI.

Negative real-time RT-PCR results for H7 were explained by the presence of 8-nt substitutions within the primer and probe target sites: 2 and 1 in the forward and reverse primers, respectively, and 5 in the probe. This real-time RT-PCR assay for H7 (2) did not detect several H7 viruses subsequently isolated from wild birds in 2007, a finding that has also been reported by Xing et al. (6).

Epidemiologic investigations conducted on poultry farms surrounding the index premises, including 6 farms located within the 3-km surveillance zone, showed no evidence of avian influenza virus infection. Sharing of equipment, movement of employees among the barns, and lack of designated footwear or clothing for each employee on the index farm increased the likelihood of inadvertent introduction of environmental contaminants. The barns used a municipal water source, but during high demand periods surface water from a dugout located ≈380 m from the breeder barns was also used. This water was routinely filtered and treated with ozone, but a failure of the ozonater was reported during July. Several small natural water bodies are also located near the premises, the closest being 1,100 m away. Last Mountain Lake, which has a length of 80 km and a waterfowl staging area at its northern end, is located 5.5 km away.

Serologic testing was conducted to evaluate the length of time an avian influenza virus (H7N3) had been circulating on the premises. Of serum samples obtained from 24-week-old roosters on September 23, 62% (18/29) had antibodies against avian influenza virus nucleoprotein (NP) (7); all were negative for antibodies against H7 (4). Analysis of serum samples from surviving roosters 3 days later showed that 90% (18/20) had antibodies against NP and 84% (16/19) had antibodies against H7. In contrast, 100% (21/21) of 32-week-old breeder hens had antibodies against NP and 93% (14/15) had antibodies against H7, and 95% (19/20) of 55-week-old breeder hens had antibodies against NP and 87% (14/16) had antibodies against H7. These results suggest that breeders had been infected longer than roosters.

Figure 1

Figure 1. Avian influenza virus H7-specific antibody titers of serum samples from 55-week-old breeder chickens (A), 24-week-old roosters (B), and 32-week-old breeder chickens (C), Saskatchewan, Canada, September 26, 2007...


Figure 2

Figure 2. Phyogenetic analysis of avian influenza virus H7 (A) and N3 (B) genes...

Serum samples that had been obtained from the 55-week-old flock on May 11, 2007, and the 32-week-old flock on June 8, 2007, were negative for antibodies against NP, which indicated that virus introduction occurred subsequently. Although samples from 55-week-old breeders had high H7 antibody titers, none of these birds showed overt clinical signs, which implied exposure to an avian influenza virus (H7N3) with low pathogenicity. Of note, ≈25% of 32-week-old breeders were clinically ill on September 28 (5 days after the initiation of quarantine), despite having some of the highest H7-specific antibody titers (Figure 1).

Phylogenetic analysis (Figure 2; Tables 1, 2) showed a close relationship of Saskatchewan/2007 H7N3 with recent North American H7 subtype viruses of free-flying waterfowl origin (11). Several of these viruses were isolated during an avian influenza surveillance program that had been coordinated since 2005 by the Canadian Cooperative Wildlife Health Centre. Although the wild bird surveillance program in Canada did not detect H7 viruses in 2005 (12) or 2006, a conclusion based on characterization of viruses that were isolated from all real-time RT-PCR swab samples positive for virus matrix gene, several H7 virus isolates were obtained in 2007. Most of these viruses were isolated from birds sampled in the neighboring provinces of British Columbia, Alberta, and Manitoba. The HA gene of Saskatchewan/2007 clusters with these 2007 wild bird isolates but not with the HA gene of A/chicken/British Columbia/2004 (H7N3), which was responsible for the HPAI outbreak in British Columbia. This finding further supports the hypothesis that the Saskatchewan/2007 isolate was of wild bird origin.

Conclusions
Potential breaches in biosecurity and proximity of the farm to a waterfowl habitat point to wild aquatic birds as the most likely virus source. Serologic evidence suggests that a low pathogenicity avian influenza virus (H7N3) circulated among breeder hens before roosters were exposed. Infection of 24-week-old roosters was likely associated with their movement into breeder barns on September 13, 18, and 19. This finding coincided with evolution of an HPAI virus by a process that may have involved nonhomologous recombination similar to that described for the HPAI (H7N3) outbreak in British Columbia (13). The origin of the 6-aa insert within the HA0 cleavage site remains speculative; a hypothetical protein of Gallus gallus (GenBank accession no. XM_424122) was 1 notable potential donor. The findings of this and other studies (6) emphasize the need for continually monitoring HA subtype-specific real-time RT-PCR assay performance, particularly when used in national avian influenza surveillance programs.

Acknowledgments
We thank Kevin Tierney, William Swiderski, Colleen Cottam-Birt, Marsha Leith, and Kevin Heather for excellent technical assistance.

R.G.W. was supported in part by the National Institute of Allergies and Infectious Diseases, National Institutes of Health, Department of Health and Human Services, under contract no. HHSN 266200700005C.

Dr Berhane is a virologist at the National Centre for Foreign Animal Disease, Canadian Food Inspection Agency. His primary research interests include avian influenza pathogenesis, ecology, and diagnostic test development.

References
Webster RG, Bean WJ, Gorman OT, Chambers TM, Kawaoka Y. Evoution and ecology of influenza A viruses. Microbiol Rev. 1992;56:152–79.
Spackman E, Senne DA, Myers TJ, Bulaga LL, Garber LP, Perdue ML, et al. Development of a real-time reverse transcriptase PCR assay for type A influenza virus and avian H5 and H7 hemagglutinin subtypes. J Clin Microbiol. 2002;40:3256–60. PubMed DOI
Wise MG, Suarez DL, Seal BS, Pedersen JC, Senne DA, King DJ, et al. Development of a real-time reverse-transcription PCR for detection of Newcastle disease virus RNA in clinical samples. J Clin Microbiol. 2004;42:329–38. PubMed DOI
World Organisation for Animal Health. Highly pathogenic avian influenza. In: Manual of diagnostic tests and vaccines for terrestrial animals. Paris: The Organisation; 2004. p. 258–69.
Hoffmann E, Stech J, Guan Y, Webster RG, Perez DR. Universal primer set for the full-length amplification of all influenza A viruses. Arch Virol. 2001;146:2275–89. PubMed DOI
Xing Z, Cardona C, Dao P, Crossley B, Hietala S, Boyce W. Inability of real-time reverse transcriptase PCR assay to detect subtype H7 avian influenza viruses isolated from wild birds. J Clin Microbiol. 2008;46:1844–6. PubMed DOI
Zhou EM, Chan M, Heckert RA, Riva J, Cantin MF. Evaluation of a competitive ELISA for detection of antibodies against avian influenza virus nucleoprotein. Avian Dis. 1998;42:517–22. PubMed DOI
Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596–9.
Saitou N, Nei M. The neighbour-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4:406–25.
Nei M, Gojobori T. Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol Biol Evol. 1986;3:418–26.
Krauss S, Obert CA, Franks J, Walker D, Jones K, Seiler P, et al. Influenza in migratory birds and evidence of limited intercontinental virus exchange. PLoS Pathog. 2007;3:e167. PubMed DOI
Parmley EJ, Bastien N, Booth T, Bowes V, Buck P, Breault A, et al. Wild bird influenza survey, Canada, 2005. Emerg Infect Dis. 2008;14:84–7. PubMed DOI
Pasick J, Handel K, Robinson J, Copps J, Ridd D, Hills K, et al. Intersegmental recombination between the haemagglutinin and matrix genes was responsible for the emergence of a highly pathogenic H7N3 avian influenza virus in British Columbia. J Gen Virol. 2005;86:727–31. PubMed DOI
Figures
Figure 1. Avian influenza virus H7-specific antibody titers of serum samples from 55-week-old breeder chickens (A), 24-week-old roosters (B), and 32-week-old breeder chickens (C), Saskatchewan, Canada, September 26, 2007...
Figure 2. Phyogenetic analysis of avian influenza virus H7 (A) and N3 (B) genes...

Tables (please, see the full-text)
Table 1. Comparison of 8 gene segments of avian influenza virus (H7N3) A/chicken/Saskatchewan/HR-00011/2007 with influenza virus genes from GenBank with highest sequence identity, Saskatchewan, Canada, 2007
Table 2. Comparison of 8 gene segments of avian influenza virus (H7N3) A/chicken/Saskatchewan/HR-00011/2007 with 2 recent viruses (H7N3) isolated from wild waterfowl, Saskatchewan, Canada, 2007

Suggested Citation for this Article
Berhane Y, Hisanaga T, Kehler H, Neufeld J, Manning L, Argue C, et al. Highly pathogenic avian influenza virus A (H7N3) in domestic poultry, Saskatchewan, Canada, 2007. Emerg Infect Dis [serial on the Internet]. 2009 Sep [date cited]. Available from http://www.cdc.gov/EID/content/15/9/1492.htm

DOI: 10.3201/eid1509.080231

abrir aquí para acceder al documento CDC completo:
HPAI Virus A (H7N3) in Saskatchewan, Canada, 2007 | CDC EID

H1N1 - gripe porcina - ISID/USA: alta transmisibilidad

INFLUENZA, H1N1, ALTA TRANSMISIBILIDAD: ESTIMACIONES - EEUU (NY)

Un comunicado de ProMED-mail
http://www.promedmail.org
ProMED-mail es un programa de la Sociedad Internacional de Enfermedades Infecciosas
http://www.isid.org

Fecha: 30 de agosto, 2009
Fuente: Yahoo Noticias, Salud
http://espanol.news.yahoo.com/s/30082009/2/n-health-calcula-brote-influenza-alcanzo-10.html [Editado por J. Torres]

Se calcula que la nueva influenza H1N1 infectó a cerca de 800.000 personas en la ciudad de Nueva York durante la primavera boreal, dijo un alto funcionario de salud estadounidense el domingo, quien citó un estudio que será dado a conocer esta semana.

El doctor Thomas Frieden, que encabeza los Centros de Control y Prevención de Enfermedades de Estados Unidos (CDC, por sus siglas en inglés), dijo que el estudio sugiere que el virus se propagó por la ciudad. Frieden era el comisionado de Salud de la ciudad de Nueva York antes de asumir la jefatura del CDC.

"En la ciudad de Nueva York tuvimos mucho H1N1 esta última primavera. La estimación es de alrededor de 800.000 personas, cerca de un 10 por ciento de los residentes de la ciudad de Nueva York, infectados con la influenza", dijo Frieden el domingo en una entrevista con la cadena de televisión C-SPAN. "Eso es mucha gente", añadió.

Funcionarios del Departamento de Salud de la ciudad de Nueva York dicen que el estudio completo será dado a conocer en pocos días. La influenza ha infectado a más de un millón de personas en Estados Unidos y actualmente es la primera prioridad del CDC. Otros estudios muestran además que niños más grandes y jóvenes adultos son los más propensos a la infección con el nuevo virus.

La Organización Mundial de Salud estima que un tercio de la población mundial se infectará eventualmente. El virus todavía está circulando y la mayoría de los expertos en salud esperan un rebrote en el hemisferio norte durante el otoño, por las
temperaturas bajas y la apertura de las escuelas tras las vacaciones.
Comunicado por: Jaime R. Torres [torresjaime@cantv.net]
-- ProMED-ESP
...jt
*#####################*
ProMED-mail hace el máximo esfuerzo posible para verificar los informes que incluimos en nuestros envíos, pero no garantiza la exactitud ni integridad de la información, ni de cualquier aseveración u opinión basadas en ella. El lector debe asumir todos los riesgos incurridos al utilizar la información incluida o archivada por ProMED-mail. La Sociedad Internacional de Enfermedades Infecciosas (International Society for Infectious Diseases, ISID) y los proveedores de servicio asociados a ella no serán responsables por errores u omisiones, ni sujetos a acción legal por daños o perjuicios incurridos como resultado del uso o confianza depositados en el material
comunicado o archivado por ProMED-mail.
***********************